Molecular and biological characterization of Turnip mosaic virus infecting lettuce and chard in Brazil
Marcos Roberto Ribeiro-Junior: São Paulo State University
<div><em>Turnip mosaic virus </em>(TuMV) belongs to the <em>Potyvirus</em> genus, and is a major pathogen that infects at least 418 host species. Recently, symptoms of mosaic were observed in lettuce (<em>Lactuca sativa</em>) and in chard (<em>Beta vulgaris</em> subsp. <em>vulgaris</em>) fields, during the spring of 2017 in Sao Paulo State (Brazil). Symptomatic leaves were submitted to ELISA test, using a polyclonal potyvirus antiserum (Agdia, Inc), and all the plants were found positive. Total RNA was extracted, followed by RT-PCR reaction using universal primers (W-CIEN/PV1) designed to amplify part of the potyvirus capsid protein (CP) gene, and a fragment of the expected size (~850 bp) was obtained. This fragment was sequenced for lettuce and chard samples, and both showed nucleotide identity of 96% with TuMV (GenBank: AB701725.1). Further, the complete sequence of the CP gene (~1238 bp) was amplified using a specific primers pair (Fwd: TACCTACAAGCAATCTTTG and Rev: GGCAATCGAGATACTATCTC). These amplicons were purified and sequenced, confirming the presence of TuMV in the symptomatic lettuce and chard plants. Bayesian analysis grouped the TuMV isolates from lettuce and chard in the Brassica-Raphanus-[BR] clade, which includes isolates infecting <em>Brassicae</em> and <em>Raphanus</em> species. The TuMV isolate was successfully sap-transmitted to <em>Raphanus sativus</em> and <em>Eruca sativa </em>and the infection was confirmed by RT-PCR. To our knowledge, this is the first occurrence of TuMV naturally infecting lettuce and chard plants in Brazil.</div>
|
