First Report of Tomato yellow leaf curl virus in South Carolina. K. S. Ling and A. M. Simmons, USDA-ARS, U.S. Vegetable Laboratory, Charleston, SC; R. L. Hassell and A. P. Keinath, Clemson University, Coastal Research and Education Center, Charleston, SC; and J. E. Polston, Department of Plant Pathology, University of Florida, Gainesville. Plant Dis. 90:379, 2006; published on-line as DOI: 10.1094/PD-90-0379C. Accepted for publication 2 January 2006.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5(prime)GCCGCCGAATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5(prime)GCCGCCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina.

Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.