The American Phytopathological Society (APS) is a non-profit, professional, scientific organization dedicated to the study and control of plant diseases.

Copyright 1994-2009 
The American Phytopathological Society

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada. R. R. Martin, USDA-ARS, Corvallis, OR 97330; I. E. Tzanetakis, Molecular and Cellular Biology Program and Department of Botany and Plant Pathology, Oregon State University, Corvallis, 97331; J. E. Barnes, USDA-ARS, Corvallis, OR 97330; and J. F. Elmhirst, Elmhirst Diagnostics and Research, Abbotsford, B.C., Canada. Plant Dis. 88:575, 2004; published on-line as D-2004-0309-02N, 2004. Accepted for publication 25 February 2004.


Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5(prime) CCTCTCCAACCTGCTAGACT 3(prime)) and SLRSV R (5(prime) AAGCGCATGAAGGTGTAACT 3(prime)) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states.


References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

 
Home Visitor's Center Media/Outreach Center Education Center APS Interactive
 
Careers & Placement Journals & News Online Resources Meetings
  APS Press Bookstore Member AreaDirectories & Rosters
Viewing Tips CopyrightDisclaimer