Recent advances in systematics, taxonomy, and evolution of rust fungi (Pucciniales) and their relativesM. C. AIME (1)(1) Department of Plant Pathology & Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA
Rust fungi (Basidiomycota, Pucciniomycotina, Pucciniales) consist of >7000 species of obligate plant pathogens that possess the most complex life cycles in the Eumycota. Historically there has been considerable variation in the taxonomic ranks, groupings, and names applied within these fungi and phylogenetic inference has been hampered by a lack of morphological characters and incomplete life cycle and host-specificity data. In this study, several genes (primarily 18S and 28S rDNA) were examined across the breadth of the Pucciniales to resolve systematic conflicts and provide a framework for further study of the group. It is concluded that morphology alone is a poor predictor of rust relationships at most levels. Host selection, on the other hand, has played a significant role in rust evolution. Additional questions regarding rust evolution that are addressed within a phylogenetic context include inference about ancestral rusts and the relative success of heteroecious versus autoecious lineages. Finally, molecular data are examined to make predictions about the life cycles of emergent invasive rusts.
Improving deposition and control of peanut diseases with early morning and evening fungicide spraysJ. AUGUSTO (1), T. B. Brenneman (1), P. Sumner (2), A. K. Culbreath (1)(1) Dept. Plant Pathology and (2) Dept. Biological and Agricultural Engineering, University of Georgia, Tifton, GA
The effectiveness of a fungicide is determined in part by its concentration at the site of infection. Peanut has a dense canopy that is difficult to penetrate, therefore soilborne pathogens are hard to control with conventional sprays. Four applications of chlorothalonil (1.26 kg/ha a.i.), azoxystrobin (0.88 kg/ha a.i.), pyraclostrobin (0.88 kg/ha a.i.), and prothioconazole plus tebuconazole (0.58 kg/ha a.i.) were sprayed on peanut either i) early morning (3–5 am) when leaves were folded and wet, ii) after daylight (9–11 am) with unfolded and dried leaves, or iii) in the evening (9–10 pm) when leaves were folded but dry, to compare disease control and yield. Two field experiments were conducted in 2008 with cv. Georgia Green in a split-plot design. All three spray timings provided similar control of early leaf spot (Cercospora arachidicola), but early morning and evening sprays reduced southern stem rot (Sclerotium rolfsii) incidence by 32% and 23% compared to day sprays, respectively. Early morning and evening sprays increased yield by 547 kg/ha and 312 kg/ha, respectively, compared to the day sprays. These results suggest that early morning and evening sprays are effective on foliar diseases and can improve fungicide efficacy on southern stem rot, thus increasing peanut yield.
Efficacy of Bacillus mycoides isolate J on pecan scabT. B. BRENNEMAN (1)(1) Department of Plant Pathology, University of Georgia, Tifton, GA
Pecan scab (Fusicladium effusum) is a serious disease in the humid southeastern United States and growers usually apply 6–10 applications of fungicide annually. This study evaluated the efficacy of foliar applications of B. mycoides isolate J (BMJ) applied at 2–3 week intervals at a rate of 0.29 kg/ha. The induced systemic resistance from BMJ provided significant nut scab control in trials from 2006–2008, but control was less than that from commercial standards. Tank mixes of BMJ with ½ rates of either triphenyltin hydroxide (Super Tin 80WP) or dodine were as effective as the combination of those fungicides, or a full rate of Super Tin (0.53 kg/ha). If successfully registered for use, BMJ would be a valuable option for production of organic pecans. It also offers a unique mode of action that may have value in conventionally-managed orchards facing increasing problems from resistance to other fungicides.
The impact of rust diseases on the ornamental industryJ. W. BUCK (1)(1) Dept. of Plant Pathology, University of Georgia, Griffin, GA
Relatively recent introductions of quarantine-significant rust fungi severely and negatively affected production of daylily and gladiolus, respectively. The introductions resulted in the implementation of costly quarantine and eradication measures, including crop destruction and little or no ability to ship product. Puccinia hemerocallidis was discovered on daylily in 2000 and had spread primarily on infected plants throughout much of the U.S. by 2003. At this time the federal quarantine was lifted. Uromyces transversalis was detected in Hawaii on cut gladiolus flowers in 2006 and subsequently found in Florida and California. Eradication measures have proven largely successful however repeat infestations have occurred at one farm in Florida (2007, 2008) and new infestations at homeowner locations in California (2008). Containment of U. transversalis to a limited number of sites suggests eradication is still attainable. A rapid response by regulatory agencies and cooperation by commercial growers and homeowners has limited spread of U. transversalis and additional damage to the industry.
Pathogenicity evaluations of nematophagous fungi to control the Reniform nematode (Rotylenchulus reniformis) under microplot conditionsJ. D. CASTILLO (1), K. S. Lawrence (1)(1) Auburn University, Entomology and Plant Pathology Department, Auburn, AL, USA
Nematophagous fungi were isolated from Rotylenchulus reniformis in Alabama. The pathogenicity of these fungi to control R. reniformis was evaluated under microplot conditions. Treatments were: 1) Control, 2) Temik 15G, 3) Arthrobotrys dactyloides, 4) Dactylaria brochopaga 5) Paecilomyces lilacinus, 6) Arthrobotrys dactyloides + Dactylaria brochopaga + Paecilomyces lilacinus. The experimental design was a complete randomized design with 5 repetitions, and the entire experiment was repeated twice. Fungi were grown on barley seed for 60 days, and then applied 50 cm(^3) per pot. Pots were filled with Decatur silt loam soil (sand, silt, clay of 24-49-29%) from nematode infested cotton crops. Additionally, each pot was inoculated with 2000 juveniles of R. reniformis and cotton cultivar ST 5599 BGRP was planted. Soil samples were taken at mid and late season days after planting (DAP), and nematodes extraction from 150 cm(^3) of soil by the sucrose centrifugation-flotation method. Data were analyzed with SAS version 9.1.3 software using GLM procedure, and means compared using Fisher’s protected least significant difference test. Plant growth was not affected by any fungi treatments during the season thus phytotoxicity is not a problem. Nematode numbers show that at mid season, all the treatments were similar to the control. However by late season, the Temik 15G treatment did reduced the number of nematodes compared to the control. Nematohpagous fungi treatments all produced similar numbers of nematodes as the control. When nematodes were counted using a compound microscope at 40x no colonized nematodes was observed. Previously, a reduction in numbers of R. reniformis was observed with the same fungi in autoclaved soil under greenhouse conditions. The present study suggests that there is a need to explore alternate formulations of these fungi, to provide an advantage over other microorganisms that inhabit the soil, and achieve a successful control of R. reniformis.
Characterization of developmental mutants of Fusarium graminearumS. M. CATLETT (1), K. M. Gerberich (1), S. H. Johnson (1), J. E. Flaherty (1)(1) Coker College
Fusarium graminearum is an important fungal pathogen of small grains and maize cultivated throughout the world. Losses are due to reduction in overall yield, seed quality, and contamination of infected grain with mycotoxins that make the harvest less suitable for human consumption. To better understand fungal development and its relationship with pathogenicity, we initiated a forward genetics approach to identify random-insertional mutants of F. graminearum wild-type strain (PH-1) impaired in asexual development. The process of conidiation is important to the survival and dispersal of a wide-range of fungal species that impact humans. Thus, understanding the sensing and signaling mechanisms that respond to environmental cues such as light and nutrient availability that influence fungal development, may reveal potential targets for controlling fungal pathogenesis. We identified two mutants, designated 6A8 and 8B5, that fail to produce macroconidia when cultured under conditions otherwise conducive for macroconidial development by wild-type and control strains. Two additional mutants, 8E8 and 8C2, were identified by screens developed to reveal gain-of-function phenotypes. We developed a culturing system to analyze the expression of differentially regulated genes and metabolite production in the various mutant backgrounds as compared to PH-1. Furthermore, plasmid rescue analysis has revealed the identity of a gene, putatively encoding a phosphatidylinositol transfer protein, SEC14, disrupted in mutant 8B5.
Real-time PCR-based detection and quantification of Cercospora kikuchii in soybean plantsA. K. CHANDA (1), Z. Chen (1), R. W. Schneider (1)(1) Louisiana State University Agricultural Center, Baton Rouge, LA, USA
Cercospora kikuchii (Matsumoto & Tomoyasu) is the causal agent of leaf blight and purple seed stain in soybean. Soybean leaf blight, which usually occurs at late reproductive (R5 to R6) stages, has become prevalent in the southern United States, and it has been observed in the Midwest. Significant yield losses have been attributed to this disease. The most obvious symptom is the development of a purple cast on the younger, upper leaves that are exposed to direct sunlight. Once symptoms are apparent, the disease is very difficult to control, and yield loss is assured. Therefore, it is very important to detect the pathogen in soybean well before symptoms appear in order to implement disease management practices. In this research, a set of gene-specific real-time PCR primers and probe were developed based on the NADPH-dependent reductase (CTB6) gene sequence of Cercospora kikuchii, which can differentiate Cercospora kikuchii from Cercospora sojina, the causal agent of soybean frog eye leaf spot disease. The presence of 1 pg of Cercospora kikuchii genomic DNA in soybean leaf samples was detected with confidence. Cercospora kikuchii DNA was detected in soybean leaves collected as early as 22 days after planting (V3 stage) using this set of primers, and the level of Cercospora kikuchii DNA increased from 0.002% of total leaf DNA at early vegetative stage to 0.315% at the late reproductive stage.
Efficacy of brassica amendments for cotton disease managementK. A. Cochran (1), C. S. Rothrock (1)(1) University of Arkansas
Numerous soilborne pathogens reduce stand establishment, plant development, and yields in cotton. Seedling disease pathogens, including Rhizoctonia solani, Pythium spp., Thielaviopsis basicola, and Fusarium spp., may reduce stands and early-season growth under favorable environmental conditions, even with the universal use of fungicide seed treatments. Meloidogyne incognita, the root-knot nematode, and Rotylenchulus reniformis, the reniform nematode, are common in cotton fields in the midsouth and fields are often treated with Telone II (1, 3-Dichloropropene) or Temik (Aldicarb). Brassica green manure amendments were compared with Telone II and winter fallow at two sites over two years for the management of soilborne diseases on cotton. Aboveground biomass of the Indian mustard cultivar Fumus averaged 13,000 kg/ha over sites. No changes in cotton stands were found among the treatments. However, brassica amendments were observed to reduce seedling root and hypocotyl disease symptoms in some years. Brassica amendments were observed to reduce early-season galling from the root-knot nematode in both years. Brassica treatments gave plant height increases similar to Telone II at both the root-knot nematode and reniform nematode locations. Brassica treatments reduced nematode populations compared to winter fallow throughout the growing season in both years. End-of-season cotton mapping indicated the number of bolls and yields for brassica treatments were similar or greater than those found for Telone II. Soil microfloral populations, specifically total bacterial, streptomycete, and fungal populations did not differ among treatments. Brassica winter cover crops appear to be effective in managing a number of diseases in cotton production systems and offer an alternative management strategy to fumigant nematicides.
Modeling acibenzolar-S-methyl field application for TSWV management in tobaccoA. S. CSINOS (1), S. W. Mullis (1), L. Hickman (1)(1) University of Georgia, Tifton, GA, USA
A field trial was designed to evaluate the reduction of Tomato Spotted Wilt Virus (TSWV) on tobacco using acibenzolar–S-methyl (Actigard) and Imidicloprid, (Admire). Float house applications of Actigard and Admire, plus field applications of Actigard made at one week increments after transplanting in the field, were evaluated. Admire and Actigard applied in the float house system reduced disease from 20% to 10% and disease was reduced to 3% for treatments receiving Actigard and Admire in the float house plus Actigard applications made at 5 and 6 weeks post transplant. Yields were inversely related to percent TSWV and ranged from 2,445 to 2,953 kg/ha. Numbers of thrips peaked at 5 to 6 weeks post transplant, indicating a direct relationship between thrips numbers and TSWV incidence. ELISA evaluations tended to be higher than percent incidence, suggesting not all infected plants displayed visible symptoms.
Effect of seeding rate on spotted wilt incidence in new peanut cultivars and breeding linesA. CULBREATH (4), W. Branch (3), C. Holbrook (1), B. L. Tillman (2)(1) USDA Crop Genetics & Breeding, Coastal Plain Expt. Station, Tifton, GA; (2) University of Florida, North Florida REC, Marianna, FL; (3) University of Georgia, Crop & Soil Science Dept., Tifton, GA; (4) University of Georgia, Dept. of Plant Pathology, Tifton, GA
Tomato spotted wilt, caused by thrips-vectored tomato spotted wilt virus (TSWV), is a very serious problem in peanut (Arachis hypogaea L.) in the southeastern U.S. Establishment of plant density of 13 or more plants/m of row is recommended as part of an integrated management system for minimizing losses to spotted wilt. To achieve that plant density, growers often sow 19 or more seed/m of row. Cultivars with higher levels of field resistance than that of the standard moderately resistant cultivar, Georgia Green, might allow use of lower seeding density with subsequent lower seed cost, without increasing risk of damage by spotted wilt. In one field experiment in 2008, incidence of spotted wilt in new cultivars Florida-07, Georgia-06G, and Tifguard, was 18.3, 16.2, and 15.1%, respectively, at 9.8 seed/m of row and 12.8, 10.6, and 9.6%, respectively, at 19.7 seed/m of row, while incidence in Georgia Green was 53.9% and 40.7% for those same respective seeding rates (LSD = 3.6, P = 0.05). In another experiment in 2008, incidence of spotted wilt in genotypes GA 052524, GA 052527, GA 052529, Georgia-01R, Georgia-02C, and C724-19-25 was 9.1, 10.3, 6.0, 21.8, 12.5, and 18.9%, respectively, at 9.8 seed/m of row and 6.7, 4.1, 2.4, 15.5, 6.7, and 19.6%, respectively, at 19.7 seed/m of row; whereas, incidence in Georgia Green was 48.7% and 40.1% for the 9.8 seed/m and 19.7 seed/m seeding rates, respectively (LSD = 3.8, P = 0.05). These results indicate that levels of field resistance to TSWV in several new cultivars and breeding lines are adequate to allow use of lower seeding rates than with the moderately resistant cultivar Georgia Green without increasing the risk of losses to spotted wilt.
Update on southern corn rust caused by Puccinia polysoraW. Dolezal (1), K. Tiwari (2), R. Kemerait (3), J. Pataky (4), J. Kichler (5), P. Sapp (6)(1) Pioneer Hi-Bred International, Inc., Johnston, IA; (2) Pioneer Hi-Bred International, Inc., Cairo, GA; (3) Univ. of Georgia, Dept. of Plant Pathology, Tifton, GA; (4) Univ. of Illinois, Dept. Crop Science, Urbana, IL; (5) UGA Coop. Ext., Oglethorpe, GA; (6) UGA Coop. Ext., Waynesboro, GA
Yield losses to southern corn rust, caused Puccinia polysora, of over 45% have been reported. A single dominant gene, Rpp9, has been used in North America as a source of resistance to P. polysora though this gene has not been effective in other parts of the world due to the presence of virulent races. In July 2008, an Rpp9-virulent isolate was confirmed on Rpp9-resistant corn grown in Grady Co., GA. In August 2008, isolates of P. polysora collected from Macon Co, GA were also identified as Rpp9 virulent; however, samples from Burke Co, in eastern GA were avirulent against the Rpp9 gene. We believe this is the first public documentation of Rpp9-virulent isolates of P. polysora in the continental USA in the past 50 years. Hybrids containing the Rpp9 gene may still be resistant in most of North America if the old, wild-type race of P. polysora is prevalent. If sporulating uredinia are found on hybrids with the Rpp9 gene, applications of foliar fungicides may be warranted.
Epidemiological relevance of seed detection assay to seedling transmission threshold for bacterial fruit blotch in watermelonB. Dutta (1), L. Genzlinger (1), R. Walcott (1)(1) University of Georgia, Athens, GA, USA
Bacterial fruit blotch (BFB), caused by Acidovorax avenae ssp. citrulli (Aac), is one of the most economically important diseases of watermelon worldwide. Contaminated seeds are the primary source of inoculum, and under ideal weather conditions, BFB can cause up to 100% crop loss. Seed testing is a critical component of BFB management. A disease transmission threshold of 1 infested seed per 10,000 is widely recognized as the tolerable inoculum threshold based on work done with black rot of crucifers. In practice, if 1 infested seed in 10,000 is detected, then a seedlot cannot be sold. Ideally, the detection threshold for a seed health assay should be more sensitive than the seedling transmission threshold. The objective of this research was to determine the epidemiological significance of the 1:10,000 inoculum threshold for Aac and ascertain its relevance to BFB seedling transmission. In two independent BFB seedling transmission studies conducted under greenhouse conditions, one seed with 10(^7), 10(^5), 10(^3), and 10(^1) (cfu)/seed, resulted in seedling disease in 100, 100, 75, and 15% of attempts, respectively. However, in four independent trials using immunomagnetic separation-polymerase chain reaction for seed health testing, one seed with 10(^7), 10(^5), 10(^3), and 10(^1) (cfu)/seed when combined with clean seeds (n = 10,000) separately, could be detected in 100, 100, 75, and 18.7% of attempts. These observations suggest that the 1:10,000 inoculum threshold is relevant when Aac populations are >10(^5) (cfu)/seed. When Aac populations are <10(^3) (cfu)/seed seedling transmission is significantly reduced. Hence a zero tolerance strategy is suitable for effective management of seedborne Aac inoculum.
Comparative analysis of copper tolerance testing methods in Xanthomonas axonopodis pv. vesicatoriaJ. E. GARTON (1), D. B. Langston (1), F. H. Sanders (1)(1) University of Georgia, Tifton, GA, USA
Copper-based fungicides are widely used to control bacterial spot on peppers caused by Xanthomonas axonopodis pv. vesicatoria (XAV). Currently field isolates are tested for their tolerance to copper by applying a 10(^6) cell suspension on a standard CuS0(4) amended media and monitoring the growth till 48 hours. This can be effective but only provides qualitative data. Experiments have shown that (XAV) isolates can have varying ranges of Cu tolerance. Isolates from three predetermined tolerance levels (tolerant, intermediate, and sensitive) were chosen. Treatments included nutrient broth (NB) alone, NB plus 125, 250, and 500 ppm CuSO(4). All isolates grown on NB alone grew at the expected rates and were comparable. However, on 250 ppm CuSO(4), the amount of bacterial cells present at 15 hours of growth was considerably less than the control. The tolerant isolates showed differences in OD(600) and slope of the growth curve of 0.199 and 0.3, respectively, intermediate isolates showed differences of 0.136 and 0.34, while sensitive isolates were 0.157 and 0.05. All XAV isolates were completely killed on 500 ppm CuSO(4). Results for isolates tested on 125 ppm CuSO(4) will be discussed. These results suggest that different concentrations of Cu do have an affect on different isolates with respect to their rate of growth and that Cu tolerance in XAV is quantitative.
Characterization of cucurbit powdery mildew in north FloridaA. J. Gevens (1), G. S. MAIA (1)(1) University of Florida, Gainesville, FL, USA
Powdery mildew is a common and important foliar disease of cucurbit crops in all major vegetable producing regions of the world. In Florida, cucurbit Powdery mildew occurs on cucumber, melon, squash, pumpkin, and increasingly, on watermelon. Recently, the incidence and severity of disease outbreaks in Florida has increased resulting in a rise in crop loss and a growing need for improved cultivar resistance and fungicides (2). Cucurbit Powdery mildew is known to be caused by two obligate ascomycetous fungi, Podosphaera xanthii and Golovinomyces cichoracearum (1). Multiple physiological races have been defined in both fungi using muskmelon differentials (1,3). Race 1 of P. xanthii is the most common cucurbit Powdery mildew pathogen in the eastern U.S. (3). In our 2008 study, the disease response on five muskmelon differentials (‘Topmark,’ ‘Edisto,’ PI414723, PMR 45, PMR 5) planted at two north central Florida locations (Live Oak and Citra) did not fit the characterization for any one of the 3 physiological races known to be found in the U.S. It is likely that the Powdery mildew population was composed of mixed races, or that the mix of races may have contained one or more new, or unidentified races. Based on morphological characteristics the predominant pathogen was likely P. xanthii (1). Fungicide efficacy trials with 16 treatments applied at first sign of disease were established at Live Oak and Citra with highly susceptible ‘Burpee Butterbush’ butternut squash. At both locations disease pressure was moderate and fungicides did not provide significant control of Powdery mildew when compared to the untreated controls. At Citra, three of our treatments resulted in yields that were less than our untreated control. Loss of disease control with trifloxystrobin (QoI), thiophanate methyl (MBC), and triflumizole (DMI) suggested that there may be fungicide resistance present in the Powdery mildew pathogen population.
Soil fertility related to Tomato spotted wilt virus in tobaccoR. GITAITIS (1), C. Nischwitz (1), S. W. Mullis (1), A. Csinos (1), D. Burrell (2), M. Pearce (2)(1) Department of Plant Pathology, Coastal Plain Experiment Station, University of Georgia, Tifton, GA, USA; (2) National Onion Labs, Inc, Collins, GA, USA
Tobacco plots were established in the northernmost field of the Bowen Farm near Tifton, GA along the eastern perimeter and in the center of the field in 2007 and 208, respectively. Mean severity ratings for Tomato spotted wilt virus (TSWV) were recorded for 25 different plots across the field. Soil samples were taken from multiple locations within each plot in both years and combined into a composite sample for each of the 25 sites. In addition, 84 and 170 individual tobacco plants were selected from the center area of each field and rated for TSWV in 2007 and 2008, respectively. Soil samples were taken at the base of each plant and were analyzed individually. All soil samples (composite and individual) were analyzed for macro- and micronutrients. Individual nutrient values (lbs./A) and ratios of the different nutrients were regressed against TSWV severity ratings (0–10). The r-values of two ratios, namely phosphorus/magnesium and iron/copper, were significant at P = 0.05 or better as related to TSWV severity for both composite and individual samples in both years. In addition the ratio of copper/boron had a significant r-value as related to TSWV severity in both sampling methods in 2007 as well as with individual samples but not with composite samples in 2008.
Application of flutriafol and other fungicides via drip irrigation for control of cotton root rot caused by Phymatotrichopsis omnivoraT. ISAKEIT (1), R. Minzenmayer (2), C. Sansone (3)(1) Dept. of Plant Pathology, Texas A&M University, College Station, TX and Texas AgriLife Extension (2) Ballinger, TX and (3) San Angelo, TX
The experiment was done in a cotton field near San Angelo, TX with a history of severe root rot (CRR) caused by Phymatotrichopsis omnivora. Commercial formulations of fungicides were injected with a pump into drip tape when plants were at match head square growth stage on 23 June 2008 and again, three weeks later. The drip tape was 30 cm deep under the row, with emitters every 61 cm. The treatments and rates (kg/ha active ingredient) for each application were: propiconazole (2.91), azoxystrobin (1.12), prothioconazole combined with tebuconazole (2.24 of each), tetraconazole (2.24) and flutriafol (2.24). Each treatment was replicated three times. Each replicate was a single row, 198–228 m long. At the time of the initial application, a few plants were wilted. On 2 September, the mean CRR incidence of control rows was 75%. CRR incidence was significantly (P < 0.05) less with flutriafol treatment, only 2%. CRR with tetraconazole and propiconazole treatments were also significantly (P < 0.05) less, 60% and 53% incidence, respectively. CRR incidences with prothioconazole combined with tebuconazole, and azoxystrobin treatments were 74% and 73%, respectively, which was not significantly (P < 0.05) different from the control. The data suggests that flutriafol may have efficacy for CRR management, if future experiments demonstrate a high degree of control using lower, economical rates.
The affect of Pythium spp. and cold storage on the survival of longleaf pine seedlings after outplantingD. JACKSON (1), S. A. Enebak (1), D. B. South (1)(1) School of Forestry and Wildlife Sciences, Southern Forest Nursery Management Cooperative, Auburn University, AL, USA
Prior to outplanting, cold storage of pine seedlings is a common practice used by managers of southern forest tree nurseries. Occasionally, bareroot seedling survival tends to be less after storage (>1 wk) for seedlings lifted during November to early December than when seedlings are lifted and stored in January. In contrast, survival of container-grown seedlings is not affected when stored at the same period for longer durations. There is some evidence that Pythium spp. could be infecting seedling roots through wounds sustained as they are lifted form nursery beds. The combination of the fungus, wounded roots, and the cool, moist environment in cold storage may encourage fungal growth and subsequent outplanting failure. The objective of this research was to examine if the presence of Pythium spp. had any effect on seedling survival and physiology after cold storage. Bareroot and container-grown longleaf pine (Pinus palustris) seedlings were inoculated with either P. dimorphum or P. irregulare. To simulate lifting damage, roots of container-grown seedlings in peat moss were either wounded or not wounded. After 12 weeks of storage, bareroot seedling survival was >20% and container seedling survival >70% for non-treated seedlings. Bareroot seedling survival was <5% and container-grown seedling survival >70% when inoculated with either Pythium spp. after 12 weeks of storage. To determine the effects of Pythium spp. on root growth potential, bareroot longleaf seedlings were inoculated with either P. dimorphum or P. irregulare, cold stored for 3 wk, and placed in a hydroponic system for 60 d. Root growth potential was not affected by Pythium spp., however, inoculation resulted in a reduction in root collar diameter. These results indicate that presence of Pythium spp. during cold storage can negatively affect seedling survival and early diameter growth of bareroot longleaf pine seedlings.
Impact of plant-parasitic nematodes on corn in GeorgiaR. KEMERAIT (1), F. H. Sanders (1), M. Toews (2), W. J. Ethredge (3), W. E. Harrison (4), B. Mitchell (4), J. T. Flanders (5)(1) Dept. of Plant Pathology and (2) Entomology Dept., University of Georgia, Tifton, GA, and Coop. Ext. (3) Donalsonville, GA, (4) Camilla, GA, and (5) Nashville, GA
In 2007 and 2008, corn trials were planted in Seminole Co. and in 2008 in Mitchell Co. Fields were naturally infested with root-knot nematodes (Meloidogyne incognita). In 2008 a trial was planted in Tift Co. in a field naturally infested with sting nematodes (Belonolaimus spp.). Seeds in each control were treated with Poncho 250 or Cruiser 5FS insecticides. Nematicides were Counter 15G (terbufos, 7.8 kg/ha) with untreated (2007) or insecticide-treated seed (2008) and Telone II (1,3-dichloropropene) plus insecticide-treated seeds. Telone II was applied at 28 and 46.7 L/ha (2007); and at 28 L/ha (2008). In 2007, Telone II reduced nematodes extracted per root system and increased nitrogen content in foliage over the control. Neither rate of Telone II nor Counter 15G increased yield over the control. In the 2008 Tift Co. trial, Telone II and Counter 15G improved plant vigor and yield. Telone II increased nitrogen content in foliage, plant height, and growth stage development. In 2008, Telone II improved yields over the control by 502 kg/ha (Seminole Co.) and 941 kg/ha (Mitchell Co.).
Association of fern distortion syndrome with endophytic bacteria and the use of BenlateJ. W. KLOEPPER (1), J. A. McInroy (1)(1) Dept. Entomology and Plant Pathology, Auburn University, Auburn, AL, USA
Fern distortion syndrome is a wide-spread problem in commercial production of Leatherleaf fern (Rumohra adiantiformis) in Costa Rica. Previous studies in Florida suggested that the main symptom of frond distortion was associated with history of Benlate use on this vegetatively propagated plant and stimulation of deleterious bacteria. Field and greenhouse tests were designed to confirm or refute the previous suggestion. Paired sampling of 10 ferns with distorted and 10 with normally shaped fronds was done at 6 commercial ferneries in Costa Rica. Populations of total bacteria and fluorescent pseudomonads were assessed from the rhizosphere and from inside (endophytic) rhizomes. Samples were also collected three times from two ferneries in Florida, with and without Benlate history, and the populations of bacteria in rhizosphere determined; in addition, at one time, populations of bacteria on rhizomes and inside rhizomes were determined. Results from Costa Rica revealed significantly greater populations of total bacteria inside rhizomes of ferns with distorted fronds at 5 of 6 locations, and higher populations of fluorescent pseudomonads at all locations. In Florida, significantly lower populations of fluorescent pseudomonads were found at all three sample times in rhizospheres of plants never treated with Benlate than in distorted ferns propagated from sources treated with Benlate. Also, higher populations of fluorescent pseudomonads and total bacteria were found on the surface and inside rhizomes of ferns propagated from sources treated with Benlate. Hence, our results support the previously published suggestion that distortion of fronds is associated with use of Benlate and increased populations of fluorescent pseudomonads.
Treatment of Leatherleaf fern with Benlate systemic fungicide increases populations of total and alleopathic endophytic bacteriaJ. W. KLOEPPER (1), J. A. McInroy (1)(1) Dept. Entomology and Plant Pathology, Auburn University, Auburn, AL, USA
Using molecular techniques, we previously reported that increased populations of Pseudomonas spp. were associated with Benlate use on Leatherleaf fern (2007 Phytopathology 97: S182). The current study was done to confirm and extend the previous work, using isolation techniques. All Rhizomes of Leatherleaf fern were collected from a commercial fernery in Florida where Benlate was never used. Some rhizomes were planted and grown until 3 fronds were present on each plant, and these plants were used in a spray experiment containing 8 replicate plants of 3 treatments: Benlate WP, Benlate DF, and water. Other rhizomes were directly used in a drench experiment containing the same 3 treatments plus a 6-hr-old preparation of Benlate DF. In both experiments treatments, all applications of Benlate resulted in significantly greater populations of total bacteria and fluorescent pseudomonads in the rhizosphere, on the rhizome surface, and inside rhizomes 2–4 weeks after application. Benlate treatment also resulted in significantly more deformed root hair tips and in enhanced populations of pseudomonads inside petioles 7 weeks after treatment. The percentage of allelopathic endophytic bacteria, based on testing whole bacterial cells and cell-free metabolites on cucumber seedlings, was significantly increased by Benlate. Hence, Benlate changes the microbial community and increases virulence of the community in a perennial plant.
Applications of Benlate systemic fungicide on banana reduce plant growth and increase endophytic bacteriaJ. W. KLOEPPER (1), C. Ramírez (1)(1) Dept. Entomology and Plant Pathology, Auburn University, Auburn, AL, USA
Benlate systemic fungicide has been linked to increased populations of endophytic bacteria in Leatherleaf fern. Banana, like Leatherleaf fern, develops rhizomes which contain endophytic microorganisms that will persist with the next crop. Two experiments were conducted to determine if Benlate applications change endophytic bacteria and alter plant growth of banana. Micro-propagated commercial banana plants were transplanted into field soil three months prior to treatment. Each experiment consisted of 8 replications, one plant each, with 6 treatments: spray with Benlate WP, Benlate DF, or water; drench with Benlate WP, Benlate DF, or water. Six months after Benlate application (experiment 1), all applications of Benlate resulted in significant reductions in height, shoot weight, and root weight of banana plants (P = 0.01). These reductions in plant growth were accompanied by changes in the populations of endophytic bacteria. Benlate treatment consistently increased populations of total bacteria and 3 of the 4 Benlate treatments increased populations of fluorescent pseudomonads inside pseudostems. Experiment 2 was destructively sampled 15 months after Benlate application. Compared to the appropriate controls, all Benlate treatments resulted in significant reductions in stem caliper, stem diameter, height, and weights of shoots, roots, and rhizomes. In addition, plants from all Benlate treatments had higher populations of endophytic fluorescent pseudomonads and total bacteria. Overall, the results indicate that Benlate increases populations of endophytic bacteria in banana, as it did on Leatherleaf fern. However, while the effect on Leatherleaf fern was distortion of frond shape, on banana, the effect is an overall stunting of plant growth and development.
Evaluation of commercially available plant growth-promoting rhizobacteria (PGPR) and plant extracts on sheath blight disease of rice caused by Rhizoctonia solaniK. Vijay Krishna Kumar (1), S. Krishnam Raju (2), M. S. Reddy (1), J. W. Kloepper (1), K. K. Lawrence (1)(1) Dept of Entomology & Plant Pathology, Auburn University, Auburn, AL; (2) Dept of Plant Pathology, Andhra Pradesh Rice Research Institute, Maruteru, India
Sheath blight disease of rice caused by Rhizoctonia solani is a major production constraint in all rice producing areas of the world. The annual losses due to sheath blight are estimated to be 25% under optimum conditions of disease development. Disease management is currently focused on extensive use of fungicides which has created concerns about environmental pollution, pathogen resistance and escalating costs. Field trials were conducted during rainy seasons of 2005 and 2006 in randomized block design with three replications to assess the commercially available bio-pesticide products for their effect on sheath blight. Products evaluated were Achook (Azadirachtin), Biotos (Plant activator), Tricure (Azadirachtin), Ecomonas (Pseudomonas fluorescens) and Bavistin (Carbendazim) in 2005 and Biofer (Plant extract), Biotos, Defender (Plant extract), Ecomonas, Florezen P (P. fluorescens), Trichozen (Trichoderma viride) and Bavistin in 2006. Products were applied three times as foliar sprays after appearance of first symptoms initially and repeated at 10 days interval. The disease severity was measured by adopting Highest Relative Lesion Height (HRLH) at 90 days after transplanting. The chemical (Bavistin) reduce disease severity 52% and 50% compared to the control. Corresponding reductions in disease severity with the bio-pesticides ranged from 22% to 48% in 2005 and from 15% to 31% in 2006. Specifically with PGPR, the disease reductions ranged from 14% to 38% compared to the control in both the years. Grain yields were assessed at 120 days after transplanting and significantly increased grain yields (3,901 and 1,938 kg/ha) over control (2,690 and 1,550 kg/ha) were obtained with PGPR in 2005 and 2006 respectively. Our results showed that there is a scope for effective management of sheath blight disease with the use of the currently available PGPR and other products that are available under the conditions evaluated.
The threat of Ug99 stem rust and efforts towards breeding for resistance in wheatD. MARSHALL (1)(1) USDA/ARS, Raleigh, NC
Breeding for resistance to stem rust in wheat throughout the world has been effective for over 30 years. This success has contributed to making the farm-to-table food supply chain in the United States the most effective in the world. Nevertheless, in 1999, a new race of stem rust (caused by Puccinia graminis f. sp. tritici) was detected in Uganda and has since spread east and north into Kenya, Ethiopia, Yemen, and Iran. The new race, designated Ug99, is virulent to the globally-deployed resistance gene, Sr31. Systematic screening of U.S. winter and spring wheat cultivars, breeding lines, and experimental germplasm began in 2005 in Njoro, Kenya. To date, nearly 10,000 lines have been screened for stem rust resistance in this program. Of the winter wheat cultivars in the U.S., about 65% of the hard red, 77% of the soft red, 72% of the hard white, and 93% of the soft white can be considered to be susceptible to moderately susceptible to Ug99 and its descendents having virulence to the widely deployed genes Sr24 and Sr36. The U.S. spring wheat cultivars and germplasm have greater vulnerability to Ug99 than do winter wheats. Good levels of resistance can be found in U.S. durum wheat. New sources of seedling and adult-plant resistance are being pyramided into adapted U.S. germplasm.
Determination and compatibility of putatively hypovirulent and virulent isolates of Cryphonectria parasitica collected from the Great Smoky Mountains National ParkD. F. MCNEILL (1)(1) Mississippi State University, Mississippi State, MS
A two-year study was conducted to characterize isolates of the chestnut blight fungus (Cryphonectria parasitica) from the Great Smoky Mountains National Park (GRSM). Of 339 isolates, 54 had abnormal cultural morphologies and 3 contained dsRNA. Analysis of vegetative compatibility (VC) divided all isolates into 34 groups, 16 of which only contained one isolate. A total of 19 isolates and 3 controls were inoculated onto healthy American chestnut trees in the Nantahala National Forest, North Carolina, and data on canker growth and stromata production were obtained over six months. Results from the field trial indicated that five isolates were potentially hypovirulent. Based on those data, one isolate (236-1C) has the greatest potential for use as a biological control agent for the pathogen in the GRSM, but compatibility is limited to select VC groups. Additional hypovirulent isolates representative of the other VC groups must be identified before large scale biocontrol can succeed.
Optimal timing of preventative fungicide applications for fairy ring caused by Vascellum pratense in creeping bentgrass putting greensG. L. MILLER (1), L. P. Tredway (1)(1) North Carolina State University
Fairy ring symptoms occur around the outer edge of a subsurface fungal colony, where density of mycelium is greatest. This mycelial mat can result in soil hydrophobicity, resulting in turf loss and making delivery of curative fungicide applications difficult. In 2007 and 2008, single spring applications of the low and high rates of triadimefon and tebuconazole were evaluated for control of fairy ring on ‘A-1’ creeping bentgrass maintained under putting green conditions. Each treatment was applied when 5-day average soil temperatures (2 inch depth) reached 10°C, 13°C, 16°C, 18°C, 21°C, or 24°C. Treatments were arranged in a split plot design with timing as main plots and fungicides as subplots. Fungicides were applied in 0.08 L H(2)O m(^–2) and immediately watered in by hand with 6 mm of irrigation. Surfactants were not tank-mixed with fungicides, but Cascade Plus (Precision Laboratories, Waukegan, IL) was applied on monthly intervals to prevent localized dry spot. Visual and objective disease severity ratings were taken every 7–14 days. Data were subjected to analysis of variance and means were separated with the Waller Duncan k-ratio t-test (k = 100). Fairy ring symptoms were most severe in 2007 due to drought conditions. In 2007, symptoms began to appear prior to the 24°C application timing, rendering these treatments curative in nature. In both years, all preventive fungicide treatments resulted in adequate control of fairy ring in early summer, but suppression failed later in the season. In 2007, plots treated with the low rate of triadimefon had higher disease severity in late summer than those treated with the high rate of triadimefon or either rate of tebuconazole. Area under the disease progress curve (AUDPC) was lowest for fungicides applied at 13°C, 16°C, and 18°C in 2007. In 2008, AUDPC values were highest for the earliest (10°C) and latest (24°C) application timings.
Effects of soil types on the reproduction of Rotylenchulus reniformis in cottonS. R. MOORE (1), K. S. Lawrence (1)(1) Auburn University, Auburn, AL, USA
The reniform nematode, Rotylenchulus reniformis, is a leading economic pest in cotton in Alabama. Six soil types common to Alabama were evaluated for their effects on the reproduction of R. reniformis under irrigated and non-irrigated conditions. The test was conducted in microplots placed in a factorial within a RCBD replicated five times. The soil types evaluated were a Dothan sandy loam (S-S-C = 57-28-15), a Decatur silt loam (S-S-C = 24-49-28), a Hartsells fine sandy loam (S-S-C = 56-33-11), a Ruston very fine sandy loam (S-S-C = 59-33-8), a Pacolet sandy loam (S-S-C = 75-17-8), and a Vaiden clay (S-S-C = 5-42-53). Significant interactions between soil type and irrigation occurred for nematode reproduction and yield. At harvest, R. reniformis populations were significantly higher (P < 0.10) in the Decatur silt loam over the Hartsells fine sandy loam, the Ruston very fine sandy loam, and the Pacolet sandy loam. The Decatur silt loam also had higher populations than the Vaiden clay and the Dothan sandy loam by an average of 3,785 and 5,647 vermiform/150cc soil respectively. Soil types with greater than 45% silt + clay (Decatur silt loam and Vaiden clay) had an average of 83% more R. reniformis than those without. Rotylenchulus reniformis populations were higher in the irrigated plots by an average of 54% at mid-season and an average of 30% at harvest. The Vaiden clay yielded significantly higher (P < 0.10) than all other soil types, while the Ruston very fine sandy loam yielded significantly lower (P < 0.10) than all other soil types. Yields were significantly higher (P < 0.10) in the non-irrigated plots. The combination of soil type and irrigation is directly related to R. reniformis reproduction and can potentially be used with other factors to predict cotton yield loss.
Asian soybean rust four years later: Is the disease a nonstarter or are we still at risk?R. W. Schneider (1)(1) Dept. Plant Pathology & Crop Physiology, Louisiana State University Agric. Center, Baton Rouge, LA
Asian soybean rust (ASR) was discovered in the continental United States on November 6, 2004, in Louisiana. Plans to deal with this threat to the US soybean industry were formulated and enacted prior to the 2005 season. Initiated programs included a multistate fungicide evaluation project, a program to provide Section 18 labels for fungicides, a nationwide sentinel plot program, a spore trapping and reporting network, and a publicly accessible website that continues to provide daily disease updates. While models had been formulated regarding potential damage from ASR, there was still uncertainty about the eventual effects during the 2005 season and beyond. The 2005 and 2006 seasons were unusually dry and ASR remained confined to the South where it had overwintered in Florida. Left unchecked, the disease was destructive in Florida, Georgia, Louisiana and elsewhere. In 2007, ASR was found late in the growing season as far north as Ontario, Canada. We postulate that ASR must move from the Gulf South by mid-June to pose a threat to soybeans grown in Midwestern states. This will require unusually cool spring and early summer conditions in the South with appropriate winds or storm fronts. We must await such conditions before the full effects of ASR in the U.S. can be documented.
First report of tomato yellow leaf curl virus in KentuckyK. W. SEEBOLD (1), P. B. de Sá (1), P. Vincelli (1)(1) University of Kentucky, Lexington, KY, USA
Tomato yellow leaf curl virus (TYLCV), occurs in many tomato-producing areas worldwide. In the United States, the virus was first reported in the late-1990’s in Florida, and has since been found in another eight states in the southeastern, southern, and western portions of the country. In 2005, greenhouse-grown tomatoes with symptoms suggestive of tomato yellow leaf curl were discovered. Incidence was near 100% and a significant infestation of Bemisia tabaci, a known vector of TYLCV, was observed. From symptomatic plants, DNA was extracted and degenerate primers prV324 and prC889 were used to confirm the presence of TYLCV. Additionally, primers TYLCV CP-F (5´ CTATGTCGAAGCCACCAG 3´) and TYLCV CP-R (5´ GTAACAGAAACTCATGATATA 3´) were used to obtain the complete sequence of the virus coat protein gene. Coat protein gene sequences were BLAST-searched, and were found to share 98–99% similarity with published TYLCV sequences. Additionally, three asymptomatic weeds (Acalypha, Galinsoga, and Ipomea) growing immediately adjacent to the greenhouse were sampled, and Acalypha tested positive for TYLCV despite. These results confirm the first reported case tomato yellow leaf curl, caused by TYLCV, of tomato in Kentucky. It appears likely that TYLCV was introduced into Kentucky from imported plant material carrying either the virus, the vector, or both. Although no subsequent outbreaks resulted from the case in 2005, TYLCV was again confirmed in one greenhouse in late summer of 2008. Widespread damage from tomato yellow leaf curl has not yet occurred in the state. However, multiple introductions of TYLCV (2005, 2008) point towards the potential for future problems.
FAME Analysis as an alternative means for distinguishing Meloidogyne species and racesN. S. SEKORA (2), K. S. Lawrence (2), P. Agudelo (3), E. Van Santen (1), J. A. McInroy (2)(1) Auburn University, Department of Agronomy and Soils, Auburn, AL, USA; (2) Auburn University, Department of Entomology and Plant Pathology, Auburn, AL, USA; (3) Clemson University, Department of Entomology, Soils, and Plant Sciences, Clemson, SC, USA
Fatty acid methyl ester (FAME) analysis can be used as a means for differentiating among plant-parasitic nematode genera. Species such as Rotylenchulus reniformis, Heterodera glycines, and Meloidogyne incognita all have significantly different fatty profiles (Mahalanobis distances >7.22, P < 0.0005) at concentrations greater than 250 individuals. We hypothesize that it will be possible to further demarcate among plant-parasitic species and races using FAME analysis. Fatty acids were extracted from samples containing 1000 individuals of each Meloidogyne species M. arenaria (Race 2), M. hapla, M. incognita (Races 1, 2, and 3), and M. javanica and analyzed using the FAME gas chromatography system. The resulting profiles generated by the Sherlock Analysis Software were then analyzed with the STEPDISC and CANDISC procedures of SAS version 9.1.3. All profiles were significantly different among species and races. The four Meloidogyne species separate out easily with a minimum Mahalanobis Distance (D(^2)) between M. incognita and M. arenaria (16.24, P < 0.0001). The first canonical axis defines 66.0% of the difference among species and 23.6% is defined by the second axis for a total of 89.6% defined by the first two axes. When the species are separated by race, the minimum D(^2) = 15.77 (P < 0.0001) between M. arenaria Race 2 and M. incognita Race 1. D(^2) values among M. incognita races are all significant at P < 0.0001 with a minimum distance between Race 1 and Race 3 of 57.8. A total of 82.5% of the differences among races within species was explained by the first two canonical axes; 57.6% in the first and 24.9% in the second. By incorporating these profiles into a Sherlock Analysis Software library, it is believed that the FAME method can be used to distinguish among Meloidogyne species and races and provide an alternative source of identification.
Taxonomy of the pecan scab fungus based on the cytochrome b gene sequenceM. Seyran (1), C. Nischwitz (2), K. Lewis (1), R. GITAITIS (1), K. Stevenson (1), T. Brenneman (1)(1) Department of Plant Pathology, University of Georgia, Coastal Plain Experiment Station, Tifton, GA; (2) Department of Plant Sciences, Division of Plant Pathology and Microbiology, University of Arizona, Forbes 303, Tucson, AZ
Pecan scab is the most devastating disease of pecan trees in the southeastern U.S. The pecan scab fungus was first described by George Winter in 1882 as Fusicladium effusum. However, since then, the fungus has been reclassified eight times, and renamed as Cladosporium effusum, C. caryigenum and Fusicladosporium effusum and most recently, as Fusicladium effusum based on ITS nrDNA data and conventional taxonomic methods. To better understand the taxonomy of the pecan scab fungus, in this study a conserved region of the mitochondrial cytochrome b gene was amplified and sequenced from three isolates of Fusicladium effusum and compared to other fungi. The obtained 195-201 bp sequences from these three isolates had 95% nucleic acid homology with the apple scab fungus, Venturia inaequalis. The 65 amino acids of Fusicladium effusum, had 100% amino acid homology with the amino acids coding the locus 201-266 on exon 5 of the cytochrome b gene of V. inaequalis. Additionally, in a maximum parsimony tree based on nucleotide sequences Fusicladium effusum clustered in a clade with V. inaequalis with a 92% bootstrap value. These results support the previous work that the pecan scab fungus and V. inaequalis are closely related and the fungus should be placed in the family Venturiacea.
Control of forest nursery seedling diseases of Pinus spp. with Proline 480 SCT. E. STARKEY (1), S. A. Enebak (1)(1) School of Forestry and Wildlife Sciences, Southern Forest Nursery Management Cooperative, Auburn University, AL, USA
The availability of fungicides to control specific forest seedling nursery diseases is either nonexistent, limited or faces possible loss of registration. Proline 480 SC (41% prothioconazole) is a broad-spectrum systemic fungicide labeled for the control of ascomycetes, basidiomycetes, and deuteromycetes on numerous field crops. While not registered for forest seedlings; laboratory, greenhouse and field trials have shown Proline to be efficacious against three fungal pathogens that cause significant damage and seedling mortality in forest-tree nurseries. Disease control using Proline has been obtained at a 402 ml/ha application for the control of fusiform rust (Cronartium quercum f. sp. fusiforme) on loblolly pine (Pinus taeda) in the greenhouse and in two nursery field trials. In greenhouse trials, a biweekly application (402 ml/ha) controlled pitch canker (Fusarium circinatum) on longleaf pine (Pinus palustris) and resulted in an 11% increase in seedling production over non-treated seedlings. In vitro fungal growth studies on media amended with Proline resulted in fungicidal activity against Fusarium circinatum at all 3 rates (0.25x, 0.5x and 1x the label) used. A biweekly application of Proline in nursery field tests significantly reduced Rhizoctonia foliar blight on loblolly pine when compared to Heritage (50% azoxystrobin) and the non-treated control. In addition to disease control, Proline treated seedlings were significantly larger and appeared much greener than non-treated seedlings.
Changes in chrysanthemum rhizosphere bacteria related to steam treatment and reduced plant growthA. Suárez (1), M. Ramírez (1), J. Pérez (1), N. Cardona (1), J. Calle (1), C. RAMÍREZ (1)(1) Institute of Biology, Universidad de Antioquia - Centro de Innovación de la Floricultura Colombiana, Colombia
Steam treatment of soils is common in commercial production of chrysanthemum in Colombia. Although highly effective, the beneficial effect of steam shortly disappears, and reductions of plant growth and vigor occur after the first harvest. Affected plants do not exhibit classical disease symptoms, nor are pathogens isolated from them. In attempts to overcome the growth reduction, growers re-apply steam frequently, thereby increasing production costs and potentially damaging soil health. We hypothesized that reduced plant growth, following steam treatment, is associated with increases in deleterious bacteria. To test this hypothesis, populations of total culturable and aerobic endospore-forming (AEFB) bacteria and fluorescent pseudomonads were determined in rhizosphere soil during three different planting cycles after steam treatment and compared to populations in a control chrysanthemum-cultivated soil supporting satisfactory plant growth and lacking any history of steam treatment. Significantly higher populations of all three groups were recorded in the third round of planting. However, for the second round, when the plant growth (high and fresh weight) was already significantly reduced, only increases in fluorescent pseudomonads were significant. For the first round after steam treatment, when plant growth was optimum, the populations of total bacteria and AEFB were higher in treated than in non-treated soil, whereas fluorescent pseudomonads were similar. Significant negative correlations were found between plant growth and the population of each of the bacterial groups evaluated, and the correlation coefficient was greatest for fluorescent pseudomonads. Tests for potential bacterial deleterious traits have revealed a higher proportion of indole-acetic acid-producing morphotypes of fluorescent pseudomonads in treated soils, whereas similar numbers were found for HCN production.
Detection limits and relative abundance of Aspergillus flavus in microbial communities of peanut soilsH. SUDINI (1), R. N. Huettel (1), K. Bowen (1), C. Arias (1)(1) Auburn University, Auburn, AL, USA
Extracting total DNA from field soil samples and utilizing molecular diagnostic techniques may lead to a rapid identification of soil microbial communities that may reflect soil health. This study focuses on the soil microbial community in peanut fields as influenced by cropping sequences. In order to determine the sensitivity of kits used for extraction, the minimum microbial load of aflatoxin producing Aspergillus flavus in the soil at which the pathogen can be detected among soil microbial communities was determined. The methodology involved extraction of total soil genomic DNA in different peanut cropping sequences (continuous Peanut; continuous Bahia; Peanut-Cotton; and Peanut-Corn with four replications each) and sampling times with the DNA fingerprinting technique called ARISA (Automated Ribosomal Intergenic Spacer Analysis) using universal fungal specific primers targeting the 18S-28S region. Detection of A. flavus population loads in soils was carried out using A. flavus specific primers and through quantitative estimation on AFPA (Aspergillus flavus and parasiticus Agar) medium. The population level of A. flavus from the soil samples ranged from zero to 1.2 × 10(^3) cfu g(^–1) soil but was not at detectable limits using A. flavus specific primers, FLA1 & FLA2. Investigations on determining the minimum detectable inoculum load at which the pathogen could be amplified from the total soil genomic DNA through artificial inoculation of A. flavus spore suspension at different concentrations revealed that a population density of 2.6 × 10(^8) cfu g(^–1) soil is required. Therefore, some microbial population in fields at low levels may not be detected by current techniques. However, as more specificity of primers are developed, these techniques may provide a rapid method for determining the relative population levels of aflatoxin producing fungi as well as determining detection levels need for other microbes in soils.
Genetic structure of Sclerotinia homoeocarpa populations from turfgrasses in North America, Asia and EuropeT. A. TAYLOR (1), I. Carbone (1), L. P. Tredway (1)(1) North Carolina State University
Sclerotinia homoeocarpa is the fungal pathogen responsible for dollar spot disease on turfgrasses. This pathogen infects all turf species and is found worldwide. Sclerotinia homoeocarpa was first described by F.T. Bennett in 1937. Bennett described the fungus as producing both apothecia and microsclerotia, both of which are not seen today. This has resulted in a scientific debate where most believe the fungus belongs to the family Rutstroemiaceae due to the production of substratal stromata. Isolates of S. homoeocarpa were obtained from turfgrass species collected in the United States, United Kingdom, Italy and Japan. Vegetative compatibility groups (VCGs) were evaluated on PDA amended with red food coloring, and eleven VCGs were identified in the sample population. Four loci (ITS, Beta-tubulin, IGS, and calmodulin) were amplified using PCR and then sequenced via cycle sequencing. Isolates of S. sclerotiorum, Rutstroemia paludosa and R. cuniculi were also included for comparison. All isolates analyzed thus far are distinct from S. homoeocarpa type-isolates described by Bennett in 1937. The results obtained to date indicate that genetic diversity among isolates is dependent on host species rather than geographic location, with isolates from warm- and cool-season turfgrasses separating into distinct clades. Host species is clearly a major factor that determines genetic diversity in populations of S. homoeocarpa causing dollar spot in turfgrasses. Although 10 VCGs were detected among isolates from cool-season (C3) turfgrasses, all have identical ITS, IGS, calmodulin and Beta-tubulin sequences. Additional methods such as mitochondrial gene analysis or microsatellites are needed to detect genetic variation within this group.
Efficacy of endophytes in the management of leaf blight disease of amaranth, plant growth promotion and in inducing systemic resistanceS. UPPALA (1), B. Saralamma (2), K. L. Bowen (1), M. M. Chapala (2)(1) Auburn University, Entomology and Plant Pathology Dept., Auburn, AL, USA; (2) Kerala Agricultural University, Thrissur, Kerala, India
Amaranth (Amaranthus tricolor), a member of Amaranthaceae, is a highly nutritious, inexpensive, leafy vegetable in the tropics. Among the different diseases of amaranth, leaf blight disease caused by Rhizoctonia solani Kuhn is a major production constraint. The pathogen infects more than 90% of plants in the field and causes considerable economic loss owing to reduction in the marketability of the produce. Farmers are reluctant to cultivate amaranth during monsoon seasons because of the susceptibility of this plant to leaf blight. Even though chemical control with Mancozeb is promising, use of chemicals on a regular basis is a serious human health concern. In an effort to find alternatives to chemical management, a study was conducted in Kerala in 2006–2007 to evaluate the efficiency of endophytic microbes on amaranth in the management of Rhizoctonia leaf blight. The methodology involved the isolation of endophytes, in-vitro evaluation of isolated endophytes against the pathogen R. solani, in-vivo pot culture evaluation of selected endophytes in comparison with the recommended chemical (Mancozeb at 0.2%), standard fungal (Trichoderma viride and T. harzianum) and bacterial (Pseudomonas fluorescens) biocontrol agents and estimation of enzymes related to induced systemic resistance. Forty-six bacterial and 17 fungal endophytes were isolated and evaluated against R. solani in dual culture studies. The results revealed that one endophytic fungus (EF-2) and six endophytic bacteria (EB-4, EB-20, EB-22, EB-38, EB-43 and EB-45) were antagonistic against pathogen with varying degrees of inhibition. In the pot culture experiment EB-22 and EB-43 were found to be effective in reducing leaf blight severity whereas EB-20, EB-22 and EB-43 were effective in plant growth promotion. EB-20 and EB-22 induced maximum levels of enzymes related to ISR.
Measurement of numbers of starch grains and cambial cells in roots of loblolly pinesC. H. WALKINSHAW (1)(1) Emeritus, USDA Forest Service, 2500 Shreveport Hwy, Pineville, LA
Quantitative histology was used to measure changes in diseased and healthy feeder roots of Pinus taeda L. Histological stain schedules were compared for their accuracy in describing root cell organelles. Feeder roots were fixed, cut, and stained for light microscopy. Two root traits were tabulated for their response to three staining schedules. A total of 300 sections of feeder roots were examined using the staining schedules of Papanicolaou, Hematoxylm-eosin and Periodic Schiff. No significant differences were found in the number of starch grains per cortical or cambial root cells when these three stains were compared. Starch averaged 7 grains per cell (range = 2.8 to 13). Cambial root cells averaged 8.6 grains per cell (range = 2.4 to 15). The intensity of these stains is ideal for measurements of cellular starch and cambial organelles in tree tissues affected by a variety of forest diseases.
Uredinia of Asian soybean rust as a unique niche for other fungiN. WARD (1), R. Schneider (1), M. C. Aime (1)(1) LSU Agcenter, Baton Rouge, LA
We examined uredinia of Phakopsora pachyrhizi, causal agent of Asian soybean rust, on field-grown soybean leaves as a niche for other fungi. An unidentified fungus was recovered from sporulating uredinia but not from noninfected leaves. While other fungi were recovered from uredinia, they were not unique to this niche. Observations with a scanning electron microscope revealed hyphae of this fungus intertwined with urediniospores within pustules. Inoculation of this fungus onto field-grown rust-infected leaves resulted in a significant reduction in hyaline urediniospore production within 7 days of inoculation. The fungus colonized rust pustules within 10 days, but it failed to establish on noninfected leaf surfaces. Colonized spores turned dark brown and did not germinate. There was no effect on number of urediniospores per pustule, but there was a significantly higher proportion of red-brown pustules on leaves that had been inoculated with the co-inhabitant. Prospects for using this fungus as a biological control agent will be discussed.
Effects of fumigants and in-furrow fungicides on Verticillium wilt development in peanutJ. E. Woodward (1), T. A. Wheeler (2), S. A. Russell (1), M. G. Cattaneo (1), T. A. Baughman (1)(1) Texas AgriLife Extension Service; (2) Texas AgriLife Research, Texas A&M System, Lubbock, TX
Verticillium wilt (caused by Verticillium dahliae Kleb.) is an increasingly important disease of peanut (Arachis hypogaea L.) throughout the southern High Plains of Texas. Field trials were conducted to evaluate the effects of the fumigants metam sodium or chloropicrin, as well in-furrow applications of azoxystrobin, prothioconazole, and acibenzolar-S-methyl. Metam sodium rates of 46.8 and 65.5 L/ha reduced soil populations of V. dahliae compared to non-treated controls; however, no differences in disease incidence, yield, or quality were observed. Chloropicrin did not impact V. dahliae populations. Disease incidence was 7–9% lower in plots treated with chloropicrin; however, this did not translate to any differences in yield or quality. The use of in-furrow fungicides had no effect on disease development or yield. Additional tactics need to be investigated for management of Verticillium wilt, so that peanut producers in the region can maximize yields and profitability.
Molecular and biochemical characterization of two PR10 proteins from Zea maysY. XIE (1), Z. Chen (1), R. Brown (2), T. Cleveland (2)(1) Louisiana State University, Baton Rouge, LA, USA; (2) Southern Regional Research Center, USDA-ARS, New Orleans, LA, USA
Pathogenesis-related protein 10 (PR10) is one of the seventeen pathogensis-related protein families that have been reported to play important roles in plant responses to biotic and abiotic stresses. A novel PR10 (ZmPR10.1), which has 89.8% and 85.7% identity to previous ZmPR10 in nucleotide and amino acid sequence, respectively, was recently isolated from maize. ZmPR10 and ZmPR10.1 were highly expressed in root tissues, but low in other vegetative and reproductive organs with the level of ZmPR10.1 consistently lower than that of ZmPR10 in all tissues examined. The expressions of both genes were induced by most abiotic stresses including ethephon, SA, CuCl(2), H(2)O(2), coldness, darkness and wound, and biotic stresses such as Erwinia stewartii and Aspergillus flavus infection. However, their expressions were up-regulated initially, but down-regulated later when treated with KT, GA(3), MeJA or NaCl. ZmPR10.1 possessed significantly higher (8-fold) RNase activity in vitro than ZmPR10 with the optimum pH and temperature for both proteins at 6.5 and 55°C, respectively. Their activity was significantly inhibited in the presence of 1.0 mM Cu(^2+), Ag(^+), Co(^2+), SDS, EDTA, or DTT. In addition, ZmPR10.1 like ZmPR10 also showed antifungal activity against A. flavus, the causal agent of pre- and post-harvest aflatoxin contamination in several major agricultural crops.