|
|
|
|
2009 Southern Division
Meeting Abstracts
(Joint with the Southern Association of Agricultural Scientists (SAAS)
February 1-2, 2009 - Atlanta, Georgia
Recent advances in systematics, taxonomy, and evolution of rust fungi
(Pucciniales) and their relatives
M. C. AIME (1)
(1) Department of Plant Pathology & Crop Physiology, Louisiana State University
Agricultural Center, Baton Rouge, LA
Rust fungi (Basidiomycota, Pucciniomycotina, Pucciniales) consist of >7000
species of obligate plant pathogens that possess the most complex life cycles in
the Eumycota. Historically there has been considerable variation in the
taxonomic ranks, groupings, and names applied within these fungi and
phylogenetic inference has been hampered by a lack of morphological characters
and incomplete life cycle and host-specificity data. In this study, several
genes (primarily 18S and 28S rDNA) were examined across the breadth of the
Pucciniales to resolve systematic conflicts and provide a framework for further
study of the group. It is concluded that morphology alone is a poor predictor of
rust relationships at most levels. Host selection, on the other hand, has played
a significant role in rust evolution. Additional questions regarding rust
evolution that are addressed within a phylogenetic context include inference
about ancestral rusts and the relative success of heteroecious versus autoecious
lineages. Finally, molecular data are examined to make predictions about the
life cycles of emergent invasive rusts.
Improving deposition and control of peanut diseases with early morning and
evening fungicide sprays
J. AUGUSTO (1), T. B. Brenneman (1), P. Sumner (2), A. K. Culbreath (1)
(1) Dept. Plant Pathology and (2) Dept. Biological and Agricultural Engineering,
University of Georgia, Tifton, GA
The effectiveness of a fungicide is determined in part by its concentration at
the site of infection. Peanut has a dense canopy that is difficult to penetrate,
therefore soilborne pathogens are hard to control with conventional sprays. Four
applications of chlorothalonil (1.26 kg/ha a.i.), azoxystrobin (0.88 kg/ha
a.i.), pyraclostrobin (0.88 kg/ha a.i.), and prothioconazole plus tebuconazole
(0.58 kg/ha a.i.) were sprayed on peanut either i) early morning (3–5 am) when
leaves were folded and wet, ii) after daylight (9–11 am) with unfolded and dried
leaves, or iii) in the evening (9–10 pm) when leaves were folded but dry, to
compare disease control and yield. Two field experiments were conducted in 2008
with cv. Georgia Green in a split-plot design. All three spray timings provided
similar control of early leaf spot (Cercospora arachidicola), but early
morning and evening sprays reduced southern stem rot (Sclerotium rolfsii)
incidence by 32% and 23% compared to day sprays, respectively. Early morning and
evening sprays increased yield by 547 kg/ha and 312 kg/ha, respectively,
compared to the day sprays. These results suggest that early morning and evening
sprays are effective on foliar diseases and can improve fungicide efficacy on
southern stem rot, thus increasing peanut yield.
Efficacy of Bacillus mycoides isolate J on pecan scab
T. B. BRENNEMAN (1)
(1) Department of Plant Pathology, University of Georgia, Tifton, GA
Pecan scab (Fusicladium effusum) is a serious disease in the humid
southeastern United States and growers usually apply 6–10 applications of
fungicide annually. This study evaluated the efficacy of foliar applications of
B. mycoides isolate J (BMJ) applied at 2–3 week intervals at a rate of
0.29 kg/ha. The induced systemic resistance from BMJ provided significant nut
scab control in trials from 2006–2008, but control was less than that from
commercial standards. Tank mixes of BMJ with ½ rates of either triphenyltin
hydroxide (Super Tin 80WP) or dodine were as effective as the combination of
those fungicides, or a full rate of Super Tin (0.53 kg/ha). If successfully
registered for use, BMJ would be a valuable option for production of organic
pecans. It also offers a unique mode of action that may have value in
conventionally-managed orchards facing increasing problems from resistance to
other fungicides.
The impact of rust diseases on the ornamental industry
J. W. BUCK (1)
(1) Dept. of Plant Pathology, University of Georgia, Griffin, GA
Relatively recent introductions of quarantine-significant rust fungi severely
and negatively affected production of daylily and gladiolus, respectively. The
introductions resulted in the implementation of costly quarantine and
eradication measures, including crop destruction and little or no ability to
ship product. Puccinia hemerocallidis was discovered on daylily in 2000
and had spread primarily on infected plants throughout much of the U.S. by 2003.
At this time the federal quarantine was lifted. Uromyces transversalis
was detected in Hawaii on cut gladiolus flowers in 2006 and subsequently found
in Florida and California. Eradication measures have proven largely successful
however repeat infestations have occurred at one farm in Florida (2007, 2008)
and new infestations at homeowner locations in California (2008). Containment
of U. transversalis to a limited number of sites suggests eradication is
still attainable. A rapid response by regulatory agencies and cooperation by
commercial growers and homeowners has limited spread of U. transversalis
and additional damage to the industry.
Pathogenicity evaluations of nematophagous fungi to control the Reniform
nematode (Rotylenchulus reniformis) under microplot conditions
J. D. CASTILLO (1), K. S. Lawrence (1)
(1) Auburn University, Entomology and Plant Pathology Department, Auburn, AL,
USA
Nematophagous fungi were isolated from Rotylenchulus reniformis in
Alabama. The pathogenicity of these fungi to control R. reniformis was
evaluated under microplot conditions. Treatments were: 1) Control, 2) Temik 15G,
3) Arthrobotrys dactyloides, 4) Dactylaria brochopaga 5)
Paecilomyces lilacinus, 6) Arthrobotrys dactyloides + Dactylaria
brochopaga + Paecilomyces lilacinus. The experimental design was a
complete randomized design with 5 repetitions, and the entire experiment was
repeated twice. Fungi were grown on barley seed for 60 days, and then applied 50
cm(^3) per pot. Pots were filled with Decatur silt loam soil (sand, silt, clay
of 24-49-29%) from nematode infested cotton crops. Additionally, each pot was
inoculated with 2000 juveniles of R. reniformis and cotton cultivar ST
5599 BGRP was planted. Soil samples were taken at mid and late season days after
planting (DAP), and nematodes extraction from 150 cm(^3) of soil by the sucrose
centrifugation-flotation method. Data were analyzed with SAS version 9.1.3
software using GLM procedure, and means compared using Fisher’s protected least
significant difference test. Plant growth was not affected by any fungi
treatments during the season thus phytotoxicity is not a problem. Nematode
numbers show that at mid season, all the treatments were similar to the control.
However by late season, the Temik 15G treatment did reduced the number of
nematodes compared to the control. Nematohpagous fungi treatments all produced
similar numbers of nematodes as the control. When nematodes were counted using a
compound microscope at 40x no colonized nematodes was observed. Previously, a
reduction in numbers of R. reniformis was observed with the same fungi in
autoclaved soil under greenhouse conditions. The present study suggests that
there is a need to explore alternate formulations of these fungi, to provide an
advantage over other microorganisms that inhabit the soil, and achieve a
successful control of R. reniformis.
Characterization of developmental mutants of Fusarium graminearum
S. M. CATLETT (1), K. M. Gerberich (1), S. H. Johnson (1), J. E.
Flaherty (1)
(1) Coker College
Fusarium graminearum is an important fungal pathogen of small grains and
maize cultivated throughout the world. Losses are due to reduction in overall
yield, seed quality, and contamination of infected grain with mycotoxins that
make the harvest less suitable for human consumption. To better understand
fungal development and its relationship with pathogenicity, we initiated a
forward genetics approach to identify random-insertional mutants of F.
graminearum wild-type strain (PH-1) impaired in asexual development. The
process of conidiation is important to the survival and dispersal of a
wide-range of fungal species that impact humans. Thus, understanding the sensing
and signaling mechanisms that respond to environmental cues such as light and
nutrient availability that influence fungal development, may reveal potential
targets for controlling fungal pathogenesis. We identified two mutants,
designated 6A8 and 8B5, that fail to produce macroconidia when cultured under
conditions otherwise conducive for macroconidial development by wild-type and
control strains. Two additional mutants, 8E8 and 8C2, were identified by screens
developed to reveal gain-of-function phenotypes. We developed a culturing system
to analyze the expression of differentially regulated genes and metabolite
production in the various mutant backgrounds as compared to PH-1. Furthermore,
plasmid rescue analysis has revealed the identity of a gene, putatively encoding
a phosphatidylinositol transfer protein, SEC14, disrupted in mutant 8B5.
Real-time PCR-based detection and quantification of Cercospora kikuchii
in soybean plants
A. K. CHANDA (1), Z. Chen (1), R. W. Schneider (1)
(1) Louisiana State University Agricultural Center, Baton Rouge, LA, USA
Cercospora kikuchii (Matsumoto & Tomoyasu) is the causal agent of leaf
blight and purple seed stain in soybean. Soybean leaf blight, which usually
occurs at late reproductive (R5 to R6) stages, has become prevalent in the
southern United States, and it has been observed in the Midwest. Significant
yield losses have been attributed to this disease. The most obvious symptom is
the development of a purple cast on the younger, upper leaves that are exposed
to direct sunlight. Once symptoms are apparent, the disease is very difficult to
control, and yield loss is assured. Therefore, it is very important to detect
the pathogen in soybean well before symptoms appear in order to implement
disease management practices. In this research, a set of gene-specific real-time
PCR primers and probe were developed based on the NADPH-dependent reductase
(CTB6) gene sequence of Cercospora kikuchii, which can differentiate
Cercospora kikuchii from Cercospora sojina, the causal agent of
soybean frog eye leaf spot disease. The presence of 1 pg of Cercospora
kikuchii genomic DNA in soybean leaf samples was detected with confidence.
Cercospora kikuchii DNA was detected in soybean leaves collected as early
as 22 days after planting (V3 stage) using this set of primers, and the level of
Cercospora kikuchii DNA increased from 0.002% of total leaf DNA at early
vegetative stage to 0.315% at the late reproductive stage.
Efficacy of brassica amendments for cotton disease management
K. A. Cochran (1), C. S. Rothrock (1)
(1) University of Arkansas
Numerous soilborne pathogens reduce stand establishment, plant development, and
yields in cotton. Seedling disease pathogens, including Rhizoctonia solani,
Pythium spp., Thielaviopsis basicola, and Fusarium spp.,
may reduce stands and early-season growth under favorable environmental
conditions, even with the universal use of fungicide seed treatments.
Meloidogyne incognita, the root-knot nematode, and Rotylenchulus
reniformis, the reniform nematode, are common in cotton fields in the
midsouth and fields are often treated with Telone II (1, 3-Dichloropropene) or
Temik (Aldicarb). Brassica green manure amendments were compared with Telone II
and winter fallow at two sites over two years for the management of soilborne
diseases on cotton. Aboveground biomass of the Indian mustard cultivar Fumus
averaged 13,000 kg/ha over sites. No changes in cotton stands were found among
the treatments. However, brassica amendments were observed to reduce seedling
root and hypocotyl disease symptoms in some years. Brassica amendments were
observed to reduce early-season galling from the root-knot nematode in both
years. Brassica treatments gave plant height increases similar to Telone II at
both the root-knot nematode and reniform nematode locations. Brassica treatments
reduced nematode populations compared to winter fallow throughout the growing
season in both years. End-of-season cotton mapping indicated the number of bolls
and yields for brassica treatments were similar or greater than those found for
Telone II. Soil microfloral populations, specifically total bacterial,
streptomycete, and fungal populations did not differ among treatments. Brassica
winter cover crops appear to be effective in managing a number of diseases in
cotton production systems and offer an alternative management strategy to
fumigant nematicides.
Modeling acibenzolar-S-methyl field application for TSWV management in tobacco
A. S. CSINOS (1), S. W. Mullis (1), L. Hickman (1)
(1) University of Georgia, Tifton, GA, USA
A field trial was designed to evaluate the reduction of Tomato Spotted Wilt
Virus (TSWV) on tobacco using acibenzolar–S-methyl (Actigard) and Imidicloprid,
(Admire). Float house applications of Actigard and Admire, plus field
applications of Actigard made at one week increments after transplanting in the
field, were evaluated. Admire and Actigard applied in the float house system
reduced disease from 20% to 10% and disease was reduced to 3% for treatments
receiving Actigard and Admire in the float house plus Actigard applications made
at 5 and 6 weeks post transplant. Yields were inversely related to percent TSWV
and ranged from 2,445 to 2,953 kg/ha. Numbers of thrips peaked at 5 to 6 weeks
post transplant, indicating a direct relationship between thrips numbers and
TSWV incidence. ELISA evaluations tended to be higher than percent incidence,
suggesting not all infected plants displayed visible symptoms.
Effect of seeding rate on spotted wilt incidence in new peanut cultivars and
breeding lines
A. CULBREATH (4), W. Branch (3), C. Holbrook (1), B. L. Tillman (2)
(1) USDA Crop Genetics & Breeding, Coastal Plain Expt. Station, Tifton, GA; (2)
University of Florida, North Florida REC, Marianna, FL; (3) University of
Georgia, Crop & Soil Science Dept., Tifton, GA; (4) University of Georgia, Dept.
of Plant Pathology, Tifton, GA
Tomato spotted wilt, caused by thrips-vectored tomato spotted wilt virus (TSWV),
is a very serious problem in peanut (Arachis hypogaea L.) in the
southeastern U.S. Establishment of plant density of 13 or more plants/m of row
is recommended as part of an integrated management system for minimizing losses
to spotted wilt. To achieve that plant density, growers often sow 19 or more
seed/m of row. Cultivars with higher levels of field resistance than that of the
standard moderately resistant cultivar, Georgia Green, might allow use of lower
seeding density with subsequent lower seed cost, without increasing risk of
damage by spotted wilt. In one field experiment in 2008, incidence of spotted
wilt in new cultivars Florida-07, Georgia-06G, and Tifguard, was 18.3, 16.2, and
15.1%, respectively, at 9.8 seed/m of row and 12.8, 10.6, and 9.6%,
respectively, at 19.7 seed/m of row, while incidence in Georgia Green was 53.9%
and 40.7% for those same respective seeding rates (LSD = 3.6, P = 0.05). In
another experiment in 2008, incidence of spotted wilt in genotypes GA 052524, GA
052527, GA 052529, Georgia-01R, Georgia-02C, and C724-19-25 was 9.1, 10.3, 6.0,
21.8, 12.5, and 18.9%, respectively, at 9.8 seed/m of row and 6.7, 4.1, 2.4,
15.5, 6.7, and 19.6%, respectively, at 19.7 seed/m of row; whereas, incidence in
Georgia Green was 48.7% and 40.1% for the 9.8 seed/m and 19.7 seed/m seeding
rates, respectively (LSD = 3.8, P = 0.05). These results indicate that levels of
field resistance to TSWV in several new cultivars and breeding lines are
adequate to allow use of lower seeding rates than with the moderately resistant
cultivar Georgia Green without increasing the risk of losses to spotted wilt.
Update on southern corn rust caused by Puccinia polysora
W. Dolezal (1), K. Tiwari (2), R. Kemerait (3), J. Pataky (4), J.
Kichler (5), P. Sapp (6)
(1) Pioneer Hi-Bred International, Inc., Johnston, IA; (2) Pioneer Hi-Bred
International, Inc., Cairo, GA; (3) Univ. of Georgia, Dept. of Plant Pathology,
Tifton, GA; (4) Univ. of Illinois, Dept. Crop Science, Urbana, IL; (5) UGA Coop.
Ext., Oglethorpe, GA; (6) UGA Coop. Ext., Waynesboro, GA
Yield losses to southern corn rust, caused Puccinia polysora, of
over 45% have been reported. A single dominant gene, Rpp9, has been used
in North America as a source of resistance to P. polysora though this
gene has not been effective in other parts of the world due to the presence of
virulent races. In July 2008, an Rpp9-virulent isolate was confirmed on
Rpp9-resistant corn grown in Grady Co., GA. In August 2008, isolates of
P. polysora collected from Macon Co, GA were also identified as Rpp9
virulent; however, samples from Burke Co, in eastern GA were avirulent against
the Rpp9 gene. We believe this is the first public documentation of
Rpp9-virulent isolates of P. polysora in the continental USA in the
past 50 years. Hybrids containing the Rpp9 gene may still be resistant in
most of North America if the old, wild-type race of P. polysora is
prevalent. If sporulating uredinia are found on hybrids with the Rpp9
gene, applications of foliar fungicides may be warranted.
Epidemiological relevance of seed detection assay to seedling transmission
threshold for bacterial fruit blotch in watermelon
B. Dutta (1), L. Genzlinger (1), R. Walcott (1)
(1) University of Georgia, Athens, GA, USA
Bacterial fruit blotch (BFB), caused by Acidovorax avenae ssp.
citrulli (Aac), is one of the most economically important diseases of
watermelon worldwide. Contaminated seeds are the primary source of inoculum, and
under ideal weather conditions, BFB can cause up to 100% crop loss. Seed testing
is a critical component of BFB management. A disease transmission threshold of 1
infested seed per 10,000 is widely recognized as the tolerable inoculum
threshold based on work done with black rot of crucifers. In practice, if 1
infested seed in 10,000 is detected, then a seedlot cannot be sold. Ideally, the
detection threshold for a seed health assay should be more sensitive than the
seedling transmission threshold. The objective of this research was to determine
the epidemiological significance of the 1:10,000 inoculum threshold for Aac and
ascertain its relevance to BFB seedling transmission. In two independent BFB
seedling transmission studies conducted under greenhouse conditions, one seed
with 10(^7), 10(^5), 10(^3), and 10(^1) (cfu)/seed, resulted in seedling disease
in 100, 100, 75, and 15% of attempts, respectively. However, in four independent
trials using immunomagnetic separation-polymerase chain reaction for seed health
testing, one seed with 10(^7), 10(^5), 10(^3), and 10(^1) (cfu)/seed when
combined with clean seeds (n = 10,000) separately, could be detected in 100,
100, 75, and 18.7% of attempts. These observations suggest that the 1:10,000
inoculum threshold is relevant when Aac populations are >10(^5)
(cfu)/seed. When Aac populations are <10(^3) (cfu)/seed seedling
transmission is significantly reduced. Hence a zero tolerance strategy is
suitable for effective management of seedborne Aac inoculum.
Comparative analysis of copper tolerance testing methods in Xanthomonas
axonopodis pv. vesicatoria
J. E. GARTON (1), D. B. Langston (1), F. H. Sanders (1)
(1) University of Georgia, Tifton, GA, USA
Copper-based fungicides are widely used to control bacterial spot on peppers
caused by Xanthomonas axonopodis pv. vesicatoria (XAV). Currently
field isolates are tested for their tolerance to copper by applying a 10(^6)
cell suspension on a standard CuS0(4) amended media and monitoring the growth
till 48 hours. This can be effective but only provides qualitative data.
Experiments have shown that (XAV) isolates can have varying ranges of Cu
tolerance. Isolates from three predetermined tolerance levels (tolerant,
intermediate, and sensitive) were chosen. Treatments included nutrient broth
(NB) alone, NB plus 125, 250, and 500 ppm CuSO(4). All isolates grown on NB
alone grew at the expected rates and were comparable. However, on 250 ppm
CuSO(4), the amount of bacterial cells present at 15 hours of growth was
considerably less than the control. The tolerant isolates showed differences in
OD(600) and slope of the growth curve of 0.199 and 0.3, respectively,
intermediate isolates showed differences of 0.136 and 0.34, while sensitive
isolates were 0.157 and 0.05. All XAV isolates were completely killed on 500 ppm
CuSO(4). Results for isolates tested on 125 ppm CuSO(4) will be discussed. These
results suggest that different concentrations of Cu do have an affect on
different isolates with respect to their rate of growth and that Cu tolerance in
XAV is quantitative.
Characterization of cucurbit powdery mildew in north Florida
A. J. Gevens (1), G. S. MAIA (1)
(1) University of Florida, Gainesville, FL, USA
Powdery mildew is a common and important foliar disease of cucurbit crops in all
major vegetable producing regions of the world. In Florida, cucurbit Powdery
mildew occurs on cucumber, melon, squash, pumpkin, and increasingly, on
watermelon. Recently, the incidence and severity of disease outbreaks in Florida
has increased resulting in a rise in crop loss and a growing need for improved
cultivar resistance and fungicides (2). Cucurbit Powdery mildew is known to be
caused by two obligate ascomycetous fungi, Podosphaera xanthii and
Golovinomyces cichoracearum (1). Multiple physiological races have been
defined in both fungi using muskmelon differentials (1,3). Race 1 of P.
xanthii is the most common cucurbit Powdery mildew pathogen in the eastern
U.S. (3). In our 2008 study, the disease response on five muskmelon
differentials (‘Topmark,’ ‘Edisto,’ PI414723, PMR 45, PMR 5) planted at two
north central Florida locations (Live Oak and Citra) did not fit the
characterization for any one of the 3 physiological races known to be found in
the U.S. It is likely that the Powdery mildew population was composed of mixed
races, or that the mix of races may have contained one or more new, or
unidentified races. Based on morphological characteristics the predominant
pathogen was likely P. xanthii (1). Fungicide efficacy trials with 16
treatments applied at first sign of disease were established at Live Oak and
Citra with highly susceptible ‘Burpee Butterbush’ butternut squash. At both
locations disease pressure was moderate and fungicides did not provide
significant control of Powdery mildew when compared to the untreated controls.
At Citra, three of our treatments resulted in yields that were less than our
untreated control. Loss of disease control with trifloxystrobin (QoI),
thiophanate methyl (MBC), and triflumizole (DMI) suggested that there may be
fungicide resistance present in the Powdery mildew pathogen population.
Soil fertility related to Tomato spotted wilt virus in tobacco
R. GITAITIS (1), C. Nischwitz (1), S. W. Mullis (1), A. Csinos (1), D.
Burrell (2), M. Pearce (2)
(1) Department of Plant Pathology, Coastal Plain Experiment Station, University
of Georgia, Tifton, GA, USA; (2) National Onion Labs, Inc, Collins, GA, USA
Tobacco plots were established in the northernmost field of the Bowen Farm near
Tifton, GA along the eastern perimeter and in the center of the field in 2007
and 208, respectively. Mean severity ratings for Tomato spotted wilt virus
(TSWV) were recorded for 25 different plots across the field. Soil samples were
taken from multiple locations within each plot in both years and combined into a
composite sample for each of the 25 sites. In addition, 84 and 170 individual
tobacco plants were selected from the center area of each field and rated for
TSWV in 2007 and 2008, respectively. Soil samples were taken at the base of each
plant and were analyzed individually. All soil samples (composite and
individual) were analyzed for macro- and micronutrients. Individual nutrient
values (lbs./A) and ratios of the different nutrients were regressed against
TSWV severity ratings (0–10). The r-values of two ratios, namely
phosphorus/magnesium and iron/copper, were significant at P = 0.05 or better as
related to TSWV severity for both composite and individual samples in both
years. In addition the ratio of copper/boron had a significant r-value as
related to TSWV severity in both sampling methods in 2007 as well as with
individual samples but not with composite samples in 2008.
Application of flutriafol and other fungicides via drip irrigation for control
of cotton root rot caused by Phymatotrichopsis omnivora
T. ISAKEIT (1), R. Minzenmayer (2), C. Sansone (3)
(1) Dept. of Plant Pathology, Texas A&M University, College Station, TX and
Texas AgriLife Extension (2) Ballinger, TX and (3) San Angelo, TX
The experiment was done in a cotton field near San Angelo, TX with a history of
severe root rot (CRR) caused by Phymatotrichopsis omnivora. Commercial
formulations of fungicides were injected with a pump into drip tape when plants
were at match head square growth stage on 23 June 2008 and again, three weeks
later. The drip tape was 30 cm deep under the row, with emitters every 61 cm.
The treatments and rates (kg/ha active ingredient) for each application were:
propiconazole (2.91), azoxystrobin (1.12), prothioconazole combined with
tebuconazole (2.24 of each), tetraconazole (2.24) and flutriafol (2.24). Each
treatment was replicated three times. Each replicate was a single row, 198–228 m
long. At the time of the initial application, a few plants were wilted. On 2
September, the mean CRR incidence of control rows was 75%. CRR incidence was
significantly (P < 0.05) less with flutriafol treatment, only 2%. CRR
with tetraconazole and propiconazole treatments were also significantly (P
< 0.05) less, 60% and 53% incidence, respectively. CRR incidences with
prothioconazole combined with tebuconazole, and azoxystrobin treatments were
74% and 73%, respectively, which was not significantly (P < 0.05)
different from the control. The data suggests that flutriafol may have efficacy
for CRR management, if future experiments demonstrate a high degree of control
using lower, economical rates.
The affect of Pythium spp. and cold storage on the survival of longleaf
pine seedlings after outplanting
D. JACKSON (1), S. A. Enebak (1), D. B. South (1)
(1) School of Forestry and Wildlife Sciences, Southern Forest Nursery Management
Cooperative, Auburn University, AL, USA
Prior to outplanting, cold storage of pine seedlings is a common practice used
by managers of southern forest tree nurseries. Occasionally, bareroot seedling
survival tends to be less after storage (>1 wk) for seedlings lifted during
November to early December than when seedlings are lifted and stored in January.
In contrast, survival of container-grown seedlings is not affected when stored
at the same period for longer durations. There is some evidence that Pythium
spp. could be infecting seedling roots through wounds sustained as they are
lifted form nursery beds. The combination of the fungus, wounded roots, and the
cool, moist environment in cold storage may encourage fungal growth and
subsequent outplanting failure. The objective of this research was to examine if
the presence of Pythium spp. had any effect on seedling survival and
physiology after cold storage. Bareroot and container-grown longleaf pine (Pinus
palustris) seedlings were inoculated with either P. dimorphum or
P. irregulare. To simulate lifting damage, roots of container-grown
seedlings in peat moss were either wounded or not wounded. After 12 weeks of
storage, bareroot seedling survival was >20% and container seedling survival
>70% for non-treated seedlings. Bareroot seedling survival was <5% and
container-grown seedling survival >70% when inoculated with either Pythium
spp. after 12 weeks of storage. To determine the effects of Pythium
spp. on root growth potential, bareroot longleaf seedlings were inoculated with
either P. dimorphum or P. irregulare, cold stored for 3 wk, and
placed in a hydroponic system for 60 d. Root growth potential was not affected
by Pythium spp., however, inoculation resulted in a reduction in root
collar diameter. These results indicate that presence of Pythium spp.
during cold storage can negatively affect seedling survival and early diameter
growth of bareroot longleaf pine seedlings.
Impact of plant-parasitic nematodes on corn in Georgia
R. KEMERAIT (1), F. H. Sanders (1), M. Toews (2), W. J. Ethredge (3), W. E.
Harrison (4), B. Mitchell (4), J. T. Flanders (5)
(1) Dept. of Plant Pathology and (2) Entomology Dept., University of Georgia,
Tifton, GA, and Coop. Ext. (3) Donalsonville, GA, (4) Camilla, GA, and (5)
Nashville, GA
In 2007 and 2008, corn trials were planted in Seminole Co. and in 2008 in
Mitchell Co. Fields were naturally infested with root-knot nematodes (Meloidogyne
incognita). In 2008 a trial was planted in Tift Co. in a field naturally
infested with sting nematodes (Belonolaimus spp.). Seeds in each control
were treated with Poncho 250 or Cruiser 5FS insecticides. Nematicides were
Counter 15G (terbufos, 7.8 kg/ha) with untreated (2007) or insecticide-treated
seed (2008) and Telone II (1,3-dichloropropene) plus insecticide-treated seeds.
Telone II was applied at 28 and 46.7 L/ha (2007); and at 28 L/ha (2008). In
2007, Telone II reduced nematodes extracted per root system and increased
nitrogen content in foliage over the control. Neither rate of Telone II nor
Counter 15G increased yield over the control. In the 2008 Tift Co. trial, Telone
II and Counter 15G improved plant vigor and yield. Telone II increased nitrogen
content in foliage, plant height, and growth stage development. In 2008, Telone
II improved yields over the control by 502 kg/ha (Seminole Co.) and 941 kg/ha
(Mitchell Co.).
The threat of Ug99 stem rust and efforts towards breeding for resistance in
wheat
D. MARSHALL (1)
(1) USDA/ARS, Raleigh, NC
Breeding for resistance to stem rust in wheat throughout the world has been
effective for over 30 years. This success has contributed to making the
farm-to-table food supply chain in the United States the most effective in the
world. Nevertheless, in 1999, a new race of stem rust (caused by Puccinia
graminis f. sp. tritici) was detected in Uganda and has since spread
east and north into Kenya, Ethiopia, Yemen, and Iran. The new race, designated
Ug99, is virulent to the globally-deployed resistance gene, Sr31.
Systematic screening of U.S. winter and spring wheat cultivars, breeding lines,
and experimental germplasm began in 2005 in Njoro, Kenya. To date, nearly 10,000
lines have been screened for stem rust resistance in this program. Of the winter
wheat cultivars in the U.S., about 65% of the hard red, 77% of the soft red, 72%
of the hard white, and 93% of the soft white can be considered to be susceptible
to moderately susceptible to Ug99 and its descendents having virulence to the
widely deployed genes Sr24 and Sr36. The U.S. spring wheat
cultivars and germplasm have greater vulnerability to Ug99 than do winter
wheats. Good levels of resistance can be found in U.S. durum wheat. New sources
of seedling and adult-plant resistance are being pyramided into adapted U.S.
germplasm.
Determination and compatibility of putatively hypovirulent and virulent isolates
of Cryphonectria parasitica collected from the Great Smoky Mountains
National Park
D. F. MCNEILL (1)
(1) Mississippi State University, Mississippi State, MS
A two-year study was conducted to characterize isolates of the chestnut blight
fungus (Cryphonectria parasitica) from the Great Smoky Mountains National
Park (GRSM). Of 339 isolates, 54 had abnormal cultural morphologies and 3
contained dsRNA. Analysis of vegetative compatibility (VC) divided all isolates
into 34 groups, 16 of which only contained one isolate. A total of 19 isolates
and 3 controls were inoculated onto healthy American chestnut trees in the
Nantahala National Forest, North Carolina, and data on canker growth and
stromata production were obtained over six months. Results from the field trial
indicated that five isolates were potentially hypovirulent. Based on those data,
one isolate (236-1C) has the greatest potential for use as a biological control
agent for the pathogen in the GRSM, but compatibility is limited to select VC
groups. Additional hypovirulent isolates representative of the other VC groups
must be identified before large scale biocontrol can succeed.
Optimal timing of preventative fungicide applications for fairy ring caused by
Vascellum pratense in creeping bentgrass putting greens
G. L. MILLER (1), L. P. Tredway (1)
(1) North Carolina State University
Fairy ring symptoms occur around the outer edge of a subsurface fungal colony,
where density of mycelium is greatest. This mycelial mat can result in soil
hydrophobicity, resulting in turf loss and making delivery of curative fungicide
applications difficult. In 2007 and 2008, single spring applications of the low
and high rates of triadimefon and tebuconazole were evaluated for control of
fairy ring on ‘A-1’ creeping bentgrass maintained under putting green
conditions. Each treatment was applied when 5-day average soil temperatures (2
inch depth) reached 10°C, 13°C, 16°C, 18°C, 21°C, or 24°C. Treatments were
arranged in a split plot design with timing as main plots and fungicides as
subplots. Fungicides were applied in 0.08 L H(2)O m(^–2) and immediately watered
in by hand with 6 mm of irrigation. Surfactants were not tank-mixed with
fungicides, but Cascade Plus (Precision Laboratories, Waukegan, IL) was applied
on monthly intervals to prevent localized dry spot. Visual and objective disease
severity ratings were taken every 7–14 days. Data were subjected to analysis of
variance and means were separated with the Waller Duncan k-ratio t-test (k =
100). Fairy ring symptoms were most severe in 2007 due to drought conditions. In
2007, symptoms began to appear prior to the 24°C application timing, rendering
these treatments curative in nature. In both years, all preventive fungicide
treatments resulted in adequate control of fairy ring in early summer, but
suppression failed later in the season. In 2007, plots treated with the low rate
of triadimefon had higher disease severity in late summer than those treated
with the high rate of triadimefon or either rate of tebuconazole. Area under the
disease progress curve (AUDPC) was lowest for fungicides applied at 13°C, 16°C,
and 18°C in 2007. In 2008, AUDPC values were highest for the earliest (10°C) and
latest (24°C) application timings.
Effects of soil types on the reproduction of Rotylenchulus reniformis in
cotton
S. R. MOORE (1), K. S. Lawrence (1)
(1) Auburn University, Auburn, AL, USA
The reniform nematode, Rotylenchulus reniformis, is a leading economic
pest in cotton in Alabama. Six soil types common to Alabama were evaluated for
their effects on the reproduction of R. reniformis under irrigated and
non-irrigated conditions. The test was conducted in microplots placed in a
factorial within a RCBD replicated five times. The soil types evaluated were a
Dothan sandy loam (S-S-C = 57-28-15), a Decatur silt loam (S-S-C = 24-49-28), a
Hartsells fine sandy loam (S-S-C = 56-33-11), a Ruston very fine sandy loam
(S-S-C = 59-33-8), a Pacolet sandy loam (S-S-C = 75-17-8), and a Vaiden clay
(S-S-C = 5-42-53). Significant interactions between soil type and irrigation
occurred for nematode reproduction and yield. At harvest, R. reniformis
populations were significantly higher (P < 0.10) in the Decatur silt loam over
the Hartsells fine sandy loam, the Ruston very fine sandy loam, and the Pacolet
sandy loam. The Decatur silt loam also had higher populations than the Vaiden
clay and the Dothan sandy loam by an average of 3,785 and 5,647 vermiform/150cc
soil respectively. Soil types with greater than 45% silt + clay (Decatur silt
loam and Vaiden clay) had an average of 83% more R. reniformis than those
without. Rotylenchulus reniformis populations were higher in the
irrigated plots by an average of 54% at mid-season and an average of 30% at
harvest. The Vaiden clay yielded significantly higher (P < 0.10) than all other
soil types, while the Ruston very fine sandy loam yielded significantly lower (P
< 0.10) than all other soil types. Yields were significantly higher (P < 0.10)
in the non-irrigated plots. The combination of soil type and irrigation is
directly related to R. reniformis reproduction and can potentially be
used with other factors to predict cotton yield loss.
Asian soybean rust four years later: Is the disease a nonstarter or are we still
at risk?
R. W. Schneider (1)
(1) Dept. Plant Pathology & Crop Physiology, Louisiana State University Agric.
Center, Baton Rouge, LA
Asian soybean rust (ASR) was discovered in the continental United States on
November 6, 2004, in Louisiana. Plans to deal with this threat to the US soybean
industry were formulated and enacted prior to the 2005 season. Initiated
programs included a multistate fungicide evaluation project, a program to
provide Section 18 labels for fungicides, a nationwide sentinel plot program, a
spore trapping and reporting network, and a publicly accessible website that
continues to provide daily disease updates. While models had been formulated
regarding potential damage from ASR, there was still uncertainty about the
eventual effects during the 2005 season and beyond. The 2005 and 2006 seasons
were unusually dry and ASR remained confined to the South where it had
overwintered in Florida. Left unchecked, the disease was destructive in Florida,
Georgia, Louisiana and elsewhere. In 2007, ASR was found late in the growing
season as far north as Ontario, Canada. We postulate that ASR must move from the
Gulf South by mid-June to pose a threat to soybeans grown in Midwestern states.
This will require unusually cool spring and early summer conditions in the South
with appropriate winds or storm fronts. We must await such conditions before the
full effects of ASR in the U.S. can be documented.
First report of tomato yellow leaf curl virus in Kentucky
K. W. SEEBOLD (1), P. B. de Sá (1), P. Vincelli (1)
(1) University of Kentucky, Lexington, KY, USA
Tomato yellow leaf curl virus (TYLCV), occurs in many tomato-producing areas
worldwide. In the United States, the virus was first reported in the late-1990’s
in Florida, and has since been found in another eight states in the
southeastern, southern, and western portions of the country. In 2005,
greenhouse-grown tomatoes with symptoms suggestive of tomato yellow leaf curl
were discovered. Incidence was near 100% and a significant infestation of
Bemisia tabaci, a known vector of TYLCV, was observed. From symptomatic
plants, DNA was extracted and degenerate primers prV324 and prC889 were used to
confirm the presence of TYLCV. Additionally, primers TYLCV CP-F (5´
CTATGTCGAAGCCACCAG 3´) and TYLCV CP-R (5´ GTAACAGAAACTCATGATATA 3´) were used
to obtain the complete sequence of the virus coat protein gene. Coat protein
gene sequences were BLAST-searched, and were found to share 98–99% similarity
with published TYLCV sequences. Additionally, three asymptomatic weeds (Acalypha,
Galinsoga, and Ipomea) growing immediately adjacent to the
greenhouse were sampled, and Acalypha tested positive for TYLCV despite.
These results confirm the first reported case tomato yellow leaf curl, caused by
TYLCV, of tomato in Kentucky. It appears likely that TYLCV was introduced into
Kentucky from imported plant material carrying either the virus, the vector, or
both. Although no subsequent outbreaks resulted from the case in 2005, TYLCV was
again confirmed in one greenhouse in late summer of 2008. Widespread damage from
tomato yellow leaf curl has not yet occurred in the state. However, multiple
introductions of TYLCV (2005, 2008) point towards the potential for future
problems.
FAME Analysis as an alternative means for distinguishing Meloidogyne
species and races
N. S. SEKORA (2), K. S. Lawrence (2), P. Agudelo (3), E. Van Santen (1), J.
A. McInroy (2)
(1) Auburn University, Department of Agronomy and Soils, Auburn, AL, USA; (2)
Auburn University, Department of Entomology and Plant Pathology, Auburn, AL,
USA; (3) Clemson University, Department of Entomology, Soils, and Plant
Sciences, Clemson, SC, USA
Fatty acid methyl ester (FAME) analysis can be used as a means for
differentiating among plant-parasitic nematode genera. Species such as
Rotylenchulus reniformis, Heterodera glycines, and Meloidogyne
incognita all have significantly different fatty profiles (Mahalanobis
distances >7.22, P < 0.0005) at concentrations greater than
250 individuals. We hypothesize that it will be possible to further demarcate
among plant-parasitic species and races using FAME analysis. Fatty acids were
extracted from samples containing 1000 individuals of each Meloidogyne
species M. arenaria (Race 2), M. hapla, M. incognita (Races
1, 2, and 3), and M. javanica and analyzed using the FAME gas
chromatography system. The resulting profiles generated by the Sherlock Analysis
Software were then analyzed with the STEPDISC and CANDISC procedures of SAS
version 9.1.3. All profiles were significantly different among species and
races. The four Meloidogyne species separate out easily with a minimum
Mahalanobis Distance (D(^2)) between M. incognita and M. arenaria
(16.24, P < 0.0001). The first canonical axis defines 66.0% of the
difference among species and 23.6% is defined by the second axis for a total of
89.6% defined by the first two axes. When the species are separated by race, the
minimum D(^2) = 15.77 (P < 0.0001) between M. arenaria Race 2 and
M. incognita Race 1. D(^2) values among M. incognita races are all
significant at P < 0.0001 with a minimum distance between Race 1 and Race
3 of 57.8. A total of 82.5% of the differences among races within species was
explained by the first two canonical axes; 57.6% in the first and 24.9% in the
second. By incorporating these profiles into a Sherlock Analysis Software
library, it is believed that the FAME method can be used to distinguish among
Meloidogyne species and races and provide an alternative source of
identification.
Taxonomy of the pecan scab fungus based on the cytochrome b gene sequence
M. Seyran (1), C. Nischwitz (2), K. Lewis (1), R. GITAITIS (1), K. Stevenson
(1), T. Brenneman (1)
(1) Department of Plant Pathology, University of Georgia, Coastal Plain
Experiment Station, Tifton, GA; (2) Department of Plant Sciences, Division of
Plant Pathology and Microbiology, University of Arizona, Forbes 303, Tucson, AZ
Pecan scab is the most devastating disease of pecan trees in the southeastern
U.S. The pecan scab fungus was first described by George Winter in 1882 as
Fusicladium effusum. However, since then, the fungus has been reclassified
eight times, and renamed as Cladosporium effusum, C. caryigenum
and Fusicladosporium effusum and most recently, as Fusicladium effusum
based on ITS nrDNA data and conventional taxonomic methods. To better understand
the taxonomy of the pecan scab fungus, in this study a conserved region of the
mitochondrial cytochrome b gene was amplified and sequenced from three isolates
of Fusicladium effusum and compared to other fungi. The obtained 195-201
bp sequences from these three isolates had 95% nucleic acid homology with the
apple scab fungus, Venturia inaequalis. The 65 amino acids of
Fusicladium effusum, had 100% amino acid homology with the amino acids
coding the locus 201-266 on exon 5 of the cytochrome b gene of V. inaequalis.
Additionally, in a maximum parsimony tree based on nucleotide sequences
Fusicladium effusum clustered in a clade with V. inaequalis with a
92% bootstrap value. These results support the previous work that the pecan scab
fungus and V. inaequalis are closely related and the fungus should be
placed in the family Venturiacea.
Control of forest nursery seedling diseases of Pinus spp. with Proline
480 SC
T. E. STARKEY (1), S. A. Enebak (1)
(1) School of Forestry and Wildlife Sciences, Southern Forest Nursery Management
Cooperative, Auburn University, AL, USA
The availability of fungicides to control specific forest seedling nursery
diseases is either nonexistent, limited or faces possible loss of registration.
Proline 480 SC (41% prothioconazole) is a broad-spectrum systemic fungicide
labeled for the control of ascomycetes, basidiomycetes, and deuteromycetes on
numerous field crops. While not registered for forest seedlings; laboratory,
greenhouse and field trials have shown Proline to be efficacious against three
fungal pathogens that cause significant damage and seedling mortality in
forest-tree nurseries. Disease control using Proline has been obtained at a 402
ml/ha application for the control of fusiform rust (Cronartium quercum f.
sp. fusiforme) on loblolly pine (Pinus taeda) in the greenhouse
and in two nursery field trials. In greenhouse trials, a biweekly application
(402 ml/ha) controlled pitch canker (Fusarium circinatum) on longleaf
pine (Pinus palustris) and resulted in an 11% increase in seedling
production over non-treated seedlings. In vitro fungal growth studies on media
amended with Proline resulted in fungicidal activity against Fusarium
circinatum at all 3 rates (0.25x, 0.5x and 1x the label) used. A biweekly
application of Proline in nursery field tests significantly reduced
Rhizoctonia foliar blight on loblolly pine when compared to Heritage (50%
azoxystrobin) and the non-treated control. In addition to disease control,
Proline treated seedlings were significantly larger and appeared much greener
than non-treated seedlings.
Detection limits and relative abundance of Aspergillus flavus in
microbial communities of peanut soils
H. SUDINI (1), R. N. Huettel (1), K. Bowen (1), C. Arias (1)
(1) Auburn University, Auburn, AL, USA
Extracting total DNA from field soil samples and utilizing molecular diagnostic
techniques may lead to a rapid identification of soil microbial communities that
may reflect soil health. This study focuses on the soil microbial community in
peanut fields as influenced by cropping sequences. In order to determine the
sensitivity of kits used for extraction, the minimum microbial load of aflatoxin
producing Aspergillus flavus in the soil at which the pathogen can be
detected among soil microbial communities was determined. The methodology
involved extraction of total soil genomic DNA in different peanut cropping
sequences (continuous Peanut; continuous Bahia; Peanut-Cotton; and Peanut-Corn
with four replications each) and sampling times with the DNA fingerprinting
technique called ARISA (Automated Ribosomal Intergenic Spacer Analysis) using
universal fungal specific primers targeting the 18S-28S region. Detection of
A. flavus population loads in soils was carried out using A. flavus
specific primers and through quantitative estimation on AFPA (Aspergillus
flavus and parasiticus Agar) medium. The population level of A.
flavus from the soil samples ranged from zero to 1.2 × 10(^3) cfu g(^–1)
soil but was not at detectable limits using A. flavus specific primers,
FLA1 & FLA2. Investigations on determining the minimum detectable inoculum load
at which the pathogen could be amplified from the total soil genomic DNA through
artificial inoculation of A. flavus spore suspension at different
concentrations revealed that a population density of 2.6 × 10(^8) cfu g(^–1)
soil is required. Therefore, some microbial population in fields at low levels
may not be detected by current techniques. However, as more specificity of
primers are developed, these techniques may provide a rapid method for
determining the relative population levels of aflatoxin producing fungi as well
as determining detection levels need for other microbes in soils.
Genetic structure of Sclerotinia homoeocarpa populations from turfgrasses
in North America, Asia and Europe
T. A. TAYLOR (1), I. Carbone (1), L. P. Tredway (1)
(1) North Carolina State University
Sclerotinia homoeocarpa is the fungal pathogen responsible for dollar spot
disease on turfgrasses. This pathogen infects all turf species and is found
worldwide. Sclerotinia homoeocarpa was first described by F.T. Bennett in
1937. Bennett described the fungus as producing both apothecia and
microsclerotia, both of which are not seen today. This has resulted in a
scientific debate where most believe the fungus belongs to the family
Rutstroemiaceae due to the production of substratal stromata. Isolates of
S. homoeocarpa were obtained from turfgrass species collected in the United
States, United Kingdom, Italy and Japan. Vegetative compatibility groups (VCGs)
were evaluated on PDA amended with red food coloring, and eleven VCGs were
identified in the sample population. Four loci (ITS, Beta-tubulin, IGS, and
calmodulin) were amplified using PCR and then sequenced via cycle sequencing.
Isolates of S. sclerotiorum, Rutstroemia paludosa and R.
cuniculi were also included for comparison. All isolates analyzed thus far
are distinct from S. homoeocarpa type-isolates described by Bennett in
1937. The results obtained to date indicate that genetic diversity among
isolates is dependent on host species rather than geographic location, with
isolates from warm- and cool-season turfgrasses separating into distinct clades.
Host species is clearly a major factor that determines genetic diversity in
populations of S. homoeocarpa causing dollar spot in turfgrasses.
Although 10 VCGs were detected among isolates from cool-season (C3) turfgrasses,
all have identical ITS, IGS, calmodulin and Beta-tubulin sequences. Additional
methods such as mitochondrial gene analysis or microsatellites are needed to
detect genetic variation within this group.
Efficacy of endophytes in the management of leaf blight disease of amaranth,
plant growth promotion and in inducing systemic resistance
S. UPPALA (1), B. Saralamma (2), K. L. Bowen (1), M. M. Chapala (2)
(1) Auburn University, Entomology and Plant Pathology Dept., Auburn, AL, USA;
(2) Kerala Agricultural University, Thrissur, Kerala, India
Amaranth (Amaranthus tricolor), a member of Amaranthaceae, is a highly
nutritious, inexpensive, leafy vegetable in the tropics. Among the different
diseases of amaranth, leaf blight disease caused by Rhizoctonia solani
Kuhn is a major production constraint. The pathogen infects more than 90% of
plants in the field and causes considerable economic loss owing to reduction in
the marketability of the produce. Farmers are reluctant to cultivate amaranth
during monsoon seasons because of the susceptibility of this plant to leaf
blight. Even though chemical control with Mancozeb is promising, use of
chemicals on a regular basis is a serious human health concern. In an effort to
find alternatives to chemical management, a study was conducted in Kerala in
2006–2007 to evaluate the efficiency of endophytic microbes on amaranth in the
management of Rhizoctonia leaf blight. The methodology involved the isolation of
endophytes, in-vitro evaluation of isolated endophytes against the
pathogen R. solani, in-vivo pot culture evaluation of selected
endophytes in comparison with the recommended chemical (Mancozeb at 0.2%),
standard fungal (Trichoderma viride and T. harzianum) and
bacterial (Pseudomonas fluorescens) biocontrol agents and estimation of
enzymes related to induced systemic resistance. Forty-six bacterial and 17
fungal endophytes were isolated and evaluated against R. solani in dual
culture studies. The results revealed that one endophytic fungus (EF-2) and six
endophytic bacteria (EB-4, EB-20, EB-22, EB-38, EB-43 and EB-45) were
antagonistic against pathogen with varying degrees of inhibition. In the pot
culture experiment EB-22 and EB-43 were found to be effective in reducing leaf
blight severity whereas EB-20, EB-22 and EB-43 were effective in plant growth
promotion. EB-20 and EB-22 induced maximum levels of enzymes related to ISR.
Measurement of numbers of starch grains and cambial cells in roots of loblolly
pines
C. H. WALKINSHAW (1)
(1) Emeritus, USDA Forest Service, 2500 Shreveport Hwy, Pineville, LA
Quantitative histology was used to measure changes in diseased and healthy
feeder roots of Pinus taeda L. Histological stain schedules were compared
for their accuracy in describing root cell organelles. Feeder roots were fixed,
cut, and stained for light microscopy. Two root traits were tabulated for their
response to three staining schedules. A total of 300 sections of feeder roots
were examined using the staining schedules of Papanicolaou, Hematoxylm-eosin and
Periodic Schiff. No significant differences were found in the number of starch
grains per cortical or cambial root cells when these three stains were compared.
Starch averaged 7 grains per cell (range = 2.8 to 13). Cambial root cells
averaged 8.6 grains per cell (range = 2.4 to 15). The intensity of these stains
is ideal for measurements of cellular starch and cambial organelles in tree
tissues affected by a variety of forest diseases.
Uredinia of Asian soybean rust as a unique niche for other fungi
N. WARD (1), R. Schneider (1), M. C. Aime (1)
(1) LSU Agcenter, Baton Rouge, LA
We examined uredinia of Phakopsora pachyrhizi, causal agent of Asian
soybean rust, on field-grown soybean leaves as a niche for other fungi. An
unidentified fungus was recovered from sporulating uredinia but not from
noninfected leaves. While other fungi were recovered from uredinia, they were
not unique to this niche. Observations with a scanning electron microscope
revealed hyphae of this fungus intertwined with urediniospores within pustules.
Inoculation of this fungus onto field-grown rust-infected leaves resulted in a
significant reduction in hyaline urediniospore production within 7 days of
inoculation. The fungus colonized rust pustules within 10 days, but it failed to
establish on noninfected leaf surfaces. Colonized spores turned dark brown and
did not germinate. There was no effect on number of urediniospores per pustule,
but there was a significantly higher proportion of red-brown pustules on leaves
that had been inoculated with the co-inhabitant. Prospects for using this fungus
as a biological control agent will be discussed.
Effects of fumigants and in-furrow fungicides on Verticillium wilt development
in peanut
J. E. Woodward (1), T. A. Wheeler (2), S. A. Russell (1), M. G. Cattaneo
(1), T. A. Baughman (1)
(1) Texas AgriLife Extension Service; (2) Texas AgriLife Research, Texas A&M
System, Lubbock, TX
Verticillium wilt (caused by Verticillium dahliae Kleb.) is an
increasingly important disease of peanut (Arachis hypogaea L.) throughout
the southern High Plains of Texas. Field trials were conducted to evaluate the
effects of the fumigants metam sodium or chloropicrin, as well in-furrow
applications of azoxystrobin, prothioconazole, and acibenzolar-S-methyl. Metam
sodium rates of 46.8 and 65.5 L/ha reduced soil populations of V. dahliae
compared to non-treated controls; however, no differences in disease incidence,
yield, or quality were observed. Chloropicrin did not impact V. dahliae
populations. Disease incidence was 7–9% lower in plots treated with
chloropicrin; however, this did not translate to any differences in yield or
quality. The use of in-furrow fungicides had no effect on disease development or
yield. Additional tactics need to be investigated for management of Verticillium
wilt, so that peanut producers in the region can maximize yields and
profitability.
Molecular and biochemical characterization of two PR10 proteins from Zea mays
Y. XIE (1), Z. Chen (1), R. Brown (2), T. Cleveland (2)
(1) Louisiana State University, Baton Rouge, LA, USA; (2) Southern Regional
Research Center, USDA-ARS, New Orleans, LA, USA
Pathogenesis-related protein 10 (PR10) is one of the seventeen
pathogensis-related protein families that have been reported to play important
roles in plant responses to biotic and abiotic stresses. A novel PR10 (ZmPR10.1),
which has 89.8% and 85.7% identity to previous ZmPR10 in nucleotide and
amino acid sequence, respectively, was recently isolated from maize. ZmPR10
and ZmPR10.1 were highly expressed in root tissues, but low in other
vegetative and reproductive organs with the level of ZmPR10.1
consistently lower than that of ZmPR10 in all tissues examined. The
expressions of both genes were induced by most abiotic stresses including
ethephon, SA, CuCl(2), H(2)O(2), coldness, darkness and wound, and biotic
stresses such as Erwinia stewartii and Aspergillus flavus
infection. However, their expressions were up-regulated initially, but
down-regulated later when treated with KT, GA(3), MeJA or NaCl. ZmPR10.1
possessed significantly higher (8-fold) RNase activity in vitro than
ZmPR10 with the optimum pH and temperature for both proteins at 6.5 and
55°C, respectively. Their activity was significantly inhibited in the presence
of 1.0 mM Cu(^2+), Ag(^+), Co(^2+), SDS, EDTA, or DTT. In addition, ZmPR10.1
like ZmPR10 also showed antifungal activity against A. flavus, the
causal agent of pre- and post-harvest aflatoxin contamination in several major
agricultural crops.
|